Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113127527:

Variant ID: vg1113127527 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13127527
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACTAGGGCGACGACCACAGACACTTGACGGCAGGCACGAGCTAGACACTAAAGCCTTCATCCTCCAGGAACTCCTCTTCTGGGTTGGGGAAAAAATTG[A/T]
GCAAGATTGAGTACAACCACCGTACTCAGCAAGACACACCCACGAATGCAGAATAAATGCAAAGGAGTACAAGGCGGTTATAATAAAGGGGTTAGGGTTT

Reverse complement sequence

AAACCCTAACCCCTTTATTATAACCGCCTTGTACTCCTTTGCATTTATTCTGCATTCGTGGGTGTGTCTTGCTGAGTACGGTGGTTGTACTCAATCTTGC[T/A]
CAATTTTTTCCCCAACCCAGAAGAGGAGTTCCTGGAGGATGAAGGCTTTAGTGTCTAGCTCGTGCCTGCCGTCAAGTGTCTGTGGTCGTCGCCCTAGTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	0.20%	8.80%	28.67%	NA
All Indica	2759	39.80%	0.40%	14.68%	45.13%	NA
All Japonica	1512	95.90%	0.00%	0.26%	3.84%	NA
Aus	269	87.70%	0.00%	1.12%	11.15%	NA
Indica I	595	18.70%	0.00%	13.11%	68.24%	NA
Indica II	465	61.70%	0.20%	6.24%	31.83%	NA
Indica III	913	38.10%	0.70%	18.51%	42.72%	NA
Indica Intermediate	786	44.80%	0.50%	16.41%	38.30%	NA
Temperate Japonica	767	97.40%	0.00%	0.26%	2.35%	NA
Tropical Japonica	504	92.70%	0.00%	0.40%	6.94%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	73.30%	0.00%	4.44%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113127527	A -> T	LOC_Os11g22810.1	downstream_gene_variant ; 258.0bp to feature; MODIFIER	silent_mutation	Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg1113127527	A -> T	LOC_Os11g22820.1	downstream_gene_variant ; 233.0bp to feature; MODIFIER	silent_mutation	Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg1113127527	A -> T	LOC_Os11g22830.1	downstream_gene_variant ; 3630.0bp to feature; MODIFIER	silent_mutation	Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg1113127527	A -> T	LOC_Os11g22840.1	downstream_gene_variant ; 4819.0bp to feature; MODIFIER	silent_mutation	Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg1113127527	A -> T	LOC_Os11g22810-LOC_Os11g22820	intergenic_region ; MODIFIER	silent_mutation	Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg1113127527	A -> DEL	N	N	silent_mutation	Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113127527	NA	1.41E-06	mr1706	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251