\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113127527:

Variant ID: vg1113127527 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13127527
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACTAGGGCGACGACCACAGACACTTGACGGCAGGCACGAGCTAGACACTAAAGCCTTCATCCTCCAGGAACTCCTCTTCTGGGTTGGGGAAAAAATTG[A/T]
GCAAGATTGAGTACAACCACCGTACTCAGCAAGACACACCCACGAATGCAGAATAAATGCAAAGGAGTACAAGGCGGTTATAATAAAGGGGTTAGGGTTT

Reverse complement sequence

AAACCCTAACCCCTTTATTATAACCGCCTTGTACTCCTTTGCATTTATTCTGCATTCGTGGGTGTGTCTTGCTGAGTACGGTGGTTGTACTCAATCTTGC[T/A]
CAATTTTTTCCCCAACCCAGAAGAGGAGTTCCTGGAGGATGAAGGCTTTAGTGTCTAGCTCGTGCCTGCCGTCAAGTGTCTGTGGTCGTCGCCCTAGTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 0.20% 8.80% 28.67% NA
All Indica  2759 39.80% 0.40% 14.68% 45.13% NA
All Japonica  1512 95.90% 0.00% 0.26% 3.84% NA
Aus  269 87.70% 0.00% 1.12% 11.15% NA
Indica I  595 18.70% 0.00% 13.11% 68.24% NA
Indica II  465 61.70% 0.20% 6.24% 31.83% NA
Indica III  913 38.10% 0.70% 18.51% 42.72% NA
Indica Intermediate  786 44.80% 0.50% 16.41% 38.30% NA
Temperate Japonica  767 97.40% 0.00% 0.26% 2.35% NA
Tropical Japonica  504 92.70% 0.00% 0.40% 6.94% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 73.30% 0.00% 4.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113127527 A -> T LOC_Os11g22810.1 downstream_gene_variant ; 258.0bp to feature; MODIFIER silent_mutation Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg1113127527 A -> T LOC_Os11g22820.1 downstream_gene_variant ; 233.0bp to feature; MODIFIER silent_mutation Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg1113127527 A -> T LOC_Os11g22830.1 downstream_gene_variant ; 3630.0bp to feature; MODIFIER silent_mutation Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg1113127527 A -> T LOC_Os11g22840.1 downstream_gene_variant ; 4819.0bp to feature; MODIFIER silent_mutation Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg1113127527 A -> T LOC_Os11g22810-LOC_Os11g22820 intergenic_region ; MODIFIER silent_mutation Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg1113127527 A -> DEL N N silent_mutation Average:26.794; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113127527 NA 1.41E-06 mr1706 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251