\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113004581:

Variant ID: vg1113004581 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13004581
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGTCCAACAACGGCACGTTGATGTGGATCTTCTGGATTACTTCAACAAAACGAGTGAATTGCTCGTCCACTGACGGTTTCCTACTCCGTTGAGGGAAC[A/G]
GCAGCAATCATGTGTCGCAGTACTCTTGCGGCACTGTCTTTTTTGGCTGAACTTCCTTGTCAGTCGAGCCATTAGATGGCGCTTCTTTTGATATCCCATT

Reverse complement sequence

AATGGGATATCAAAAGAAGCGCCATCTAATGGCTCGACTGACAAGGAAGTTCAGCCAAAAAAGACAGTGCCGCAAGAGTACTGCGACACATGATTGCTGC[T/C]
GTTCCCTCAACGGAGTAGGAAACCGTCAGTGGACGAGCAATTCACTCGTTTTGTTGAAGTAATCCAGAAGATCCACATCAACGTGCCGTTGTTGGACGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 17.60% 12.48% 32.99% NA
All Indica  2759 6.80% 20.10% 19.90% 53.21% NA
All Japonica  1512 94.90% 1.90% 0.93% 2.31% NA
Aus  269 1.50% 82.50% 4.83% 11.15% NA
Indica I  595 12.60% 13.60% 15.13% 58.66% NA
Indica II  465 6.70% 8.60% 20.65% 64.09% NA
Indica III  913 2.50% 28.70% 22.78% 46.00% NA
Indica Intermediate  786 7.50% 21.80% 19.72% 51.02% NA
Temperate Japonica  767 96.30% 2.20% 0.13% 1.30% NA
Tropical Japonica  504 91.50% 2.20% 2.58% 3.77% NA
Japonica Intermediate  241 97.50% 0.00% 0.00% 2.49% NA
VI/Aromatic  96 85.40% 13.50% 0.00% 1.04% NA
Intermediate  90 38.90% 17.80% 15.56% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113004581 A -> DEL N N silent_mutation Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1113004581 A -> G LOC_Os11g22600.1 upstream_gene_variant ; 2623.0bp to feature; MODIFIER silent_mutation Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1113004581 A -> G LOC_Os11g22620.1 downstream_gene_variant ; 2021.0bp to feature; MODIFIER silent_mutation Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1113004581 A -> G LOC_Os11g22610.1 intron_variant ; MODIFIER silent_mutation Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113004581 NA 9.91E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 NA 1.32E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 NA 3.62E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 NA 6.81E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 NA 5.45E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 5.02E-06 2.39E-08 mr1901 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 NA 7.28E-07 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581 NA 1.35E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251