Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113004581:

Variant ID: vg1113004581 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13004581
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGTCCAACAACGGCACGTTGATGTGGATCTTCTGGATTACTTCAACAAAACGAGTGAATTGCTCGTCCACTGACGGTTTCCTACTCCGTTGAGGGAAC[A/G]
GCAGCAATCATGTGTCGCAGTACTCTTGCGGCACTGTCTTTTTTGGCTGAACTTCCTTGTCAGTCGAGCCATTAGATGGCGCTTCTTTTGATATCCCATT

Reverse complement sequence

AATGGGATATCAAAAGAAGCGCCATCTAATGGCTCGACTGACAAGGAAGTTCAGCCAAAAAAGACAGTGCCGCAAGAGTACTGCGACACATGATTGCTGC[T/C]
GTTCCCTCAACGGAGTAGGAAACCGTCAGTGGACGAGCAATTCACTCGTTTTGTTGAAGTAATCCAGAAGATCCACATCAACGTGCCGTTGTTGGACGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.90%	17.60%	12.48%	32.99%	NA
All Indica	2759	6.80%	20.10%	19.90%	53.21%	NA
All Japonica	1512	94.90%	1.90%	0.93%	2.31%	NA
Aus	269	1.50%	82.50%	4.83%	11.15%	NA
Indica I	595	12.60%	13.60%	15.13%	58.66%	NA
Indica II	465	6.70%	8.60%	20.65%	64.09%	NA
Indica III	913	2.50%	28.70%	22.78%	46.00%	NA
Indica Intermediate	786	7.50%	21.80%	19.72%	51.02%	NA
Temperate Japonica	767	96.30%	2.20%	0.13%	1.30%	NA
Tropical Japonica	504	91.50%	2.20%	2.58%	3.77%	NA
Japonica Intermediate	241	97.50%	0.00%	0.00%	2.49%	NA
VI/Aromatic	96	85.40%	13.50%	0.00%	1.04%	NA
Intermediate	90	38.90%	17.80%	15.56%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113004581	A -> DEL	N	N	silent_mutation	Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1113004581	A -> G	LOC_Os11g22600.1	upstream_gene_variant ; 2623.0bp to feature; MODIFIER	silent_mutation	Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1113004581	A -> G	LOC_Os11g22620.1	downstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1113004581	A -> G	LOC_Os11g22610.1	intron_variant ; MODIFIER	silent_mutation	Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113004581	NA	9.91E-06	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	NA	1.32E-06	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	NA	3.62E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	NA	6.81E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	NA	5.45E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	5.02E-06	2.39E-08	mr1901	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	NA	7.28E-07	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113004581	NA	1.35E-06	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251