\
| Variant ID: vg1113004581 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13004581 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 222. )
GGCGTCCAACAACGGCACGTTGATGTGGATCTTCTGGATTACTTCAACAAAACGAGTGAATTGCTCGTCCACTGACGGTTTCCTACTCCGTTGAGGGAAC[A/G]
GCAGCAATCATGTGTCGCAGTACTCTTGCGGCACTGTCTTTTTTGGCTGAACTTCCTTGTCAGTCGAGCCATTAGATGGCGCTTCTTTTGATATCCCATT
AATGGGATATCAAAAGAAGCGCCATCTAATGGCTCGACTGACAAGGAAGTTCAGCCAAAAAAGACAGTGCCGCAAGAGTACTGCGACACATGATTGCTGC[T/C]
GTTCCCTCAACGGAGTAGGAAACCGTCAGTGGACGAGCAATTCACTCGTTTTGTTGAAGTAATCCAGAAGATCCACATCAACGTGCCGTTGTTGGACGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.90% | 17.60% | 12.48% | 32.99% | NA |
| All Indica | 2759 | 6.80% | 20.10% | 19.90% | 53.21% | NA |
| All Japonica | 1512 | 94.90% | 1.90% | 0.93% | 2.31% | NA |
| Aus | 269 | 1.50% | 82.50% | 4.83% | 11.15% | NA |
| Indica I | 595 | 12.60% | 13.60% | 15.13% | 58.66% | NA |
| Indica II | 465 | 6.70% | 8.60% | 20.65% | 64.09% | NA |
| Indica III | 913 | 2.50% | 28.70% | 22.78% | 46.00% | NA |
| Indica Intermediate | 786 | 7.50% | 21.80% | 19.72% | 51.02% | NA |
| Temperate Japonica | 767 | 96.30% | 2.20% | 0.13% | 1.30% | NA |
| Tropical Japonica | 504 | 91.50% | 2.20% | 2.58% | 3.77% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 85.40% | 13.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 38.90% | 17.80% | 15.56% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113004581 | A -> DEL | N | N | silent_mutation | Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1113004581 | A -> G | LOC_Os11g22600.1 | upstream_gene_variant ; 2623.0bp to feature; MODIFIER | silent_mutation | Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1113004581 | A -> G | LOC_Os11g22620.1 | downstream_gene_variant ; 2021.0bp to feature; MODIFIER | silent_mutation | Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| vg1113004581 | A -> G | LOC_Os11g22610.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.54; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113004581 | NA | 9.91E-06 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | NA | 1.32E-06 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | NA | 3.62E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | NA | 6.81E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | NA | 5.45E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | 5.02E-06 | 2.39E-08 | mr1901 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | NA | 7.28E-07 | mr1901 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113004581 | NA | 1.35E-06 | mr1255_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |