\
| Variant ID: vg1112979407 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12979407 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTCATGTAGAGTTCTGCTAGTTTCTTTCCATCAAAGGTGGTTTTCACTGGCACGAAATGAGCTGATTTCATGAGTCAATCCACGATTATCCAGATGGAGT[C/T,A]
GTACCCACTAGGGGTTCTTGGCAAACCGGTGATGAAATCCATTCTATCTCTTCCCATTTGCACTCGGGAATCGATAGGGGTTGCAGCAGACCAGCTGGCC
GGCCAGCTGGTCTGCTGCAACCCCTATCGATTCCCGAGTGCAAATGGGAAGAGATAGAATGGATTTCATCACCGGTTTGCCAAGAACCCCTAGTGGGTAC[G/A,T]
ACTCCATCTGGATAATCGTGGATTGACTCATGAAATCAGCTCATTTCGTGCCAGTGAAAACCACCTTTGATGGAAAGAAACTAGCAGAACTCTACATGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 0.50% | 25.58% | 9.71% | A: 0.02% |
| All Indica | 2759 | 41.60% | 0.80% | 42.12% | 15.37% | A: 0.04% |
| All Japonica | 1512 | 98.10% | 0.00% | 0.79% | 1.06% | NA |
| Aus | 269 | 89.20% | 0.40% | 6.69% | 3.72% | NA |
| Indica I | 595 | 63.00% | 0.80% | 23.03% | 13.11% | NA |
| Indica II | 465 | 36.80% | 1.90% | 38.06% | 23.23% | NA |
| Indica III | 913 | 28.10% | 0.30% | 59.04% | 12.38% | A: 0.11% |
| Indica Intermediate | 786 | 44.00% | 0.80% | 39.31% | 15.90% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 95.80% | 0.00% | 2.18% | 1.98% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 1.10% | 16.67% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112979407 | C -> T | LOC_Os11g22570.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:10.414; most accessible tissue: Callus, score: 23.217 | N | N | N | N |
| vg1112979407 | C -> A | LOC_Os11g22570.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:10.414; most accessible tissue: Callus, score: 23.217 | N | N | N | N |
| vg1112979407 | C -> DEL | N | N | silent_mutation | Average:10.414; most accessible tissue: Callus, score: 23.217 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112979407 | 2.97E-06 | 2.97E-06 | mr1508 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112979407 | NA | 6.04E-12 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112979407 | NA | 7.39E-14 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112979407 | NA | 2.26E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112979407 | 3.62E-06 | NA | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |