\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112963070:

Variant ID: vg1112963070 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12963070
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACCTTGTCCAACTCAGACTCCGCCGATCCTGGTCGCAGCCGATCTCCATCTCGGATTCTGCTTCGACTTTATCACTGTCACGCTAGGAATTTCTATCCA[C/A]
AATTCCAAACGCTTACATGTGCGTTAAATCCTCATCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAAAAGAGTACTATCAAACTACTGATTAAT

Reverse complement sequence

ATTAATCAGTAGTTTGATAGTACTCTTTTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGATGAGGATTTAACGCACATGTAAGCGTTTGGAATT[G/T]
TGGATAGAAATTCCTAGCGTGACAGTGATAAAGTCGAAGCAGAATCCGAGATGGAGATCGGCTGCGACCAGGATCGGCGGAGTCTGAGTTGGACAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 1.00% 3.20% 32.61% NA
All Indica  2759 40.60% 1.30% 5.00% 53.10% NA
All Japonica  1512 97.20% 0.10% 0.07% 2.65% NA
Aus  269 88.80% 3.70% 4.09% 3.35% NA
Indica I  595 63.00% 0.80% 1.51% 34.62% NA
Indica II  465 37.20% 0.40% 0.43% 61.94% NA
Indica III  913 25.60% 2.10% 8.54% 63.75% NA
Indica Intermediate  786 43.00% 1.30% 6.23% 49.49% NA
Temperate Japonica  767 99.30% 0.10% 0.00% 0.52% NA
Tropical Japonica  504 93.50% 0.00% 0.00% 6.55% NA
Japonica Intermediate  241 97.90% 0.40% 0.41% 1.24% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 72.20% 0.00% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112963070 C -> A LOC_Os11g22540.1 downstream_gene_variant ; 2548.0bp to feature; MODIFIER silent_mutation Average:12.134; most accessible tissue: Callus, score: 33.087 N N N N
vg1112963070 C -> A LOC_Os11g22550.1 downstream_gene_variant ; 1353.0bp to feature; MODIFIER silent_mutation Average:12.134; most accessible tissue: Callus, score: 33.087 N N N N
vg1112963070 C -> A LOC_Os11g22540-LOC_Os11g22550 intergenic_region ; MODIFIER silent_mutation Average:12.134; most accessible tissue: Callus, score: 33.087 N N N N
vg1112963070 C -> DEL N N silent_mutation Average:12.134; most accessible tissue: Callus, score: 33.087 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112963070 NA 3.48E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112963070 2.69E-06 NA mr1165_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112963070 2.84E-06 NA mr1522_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112963070 6.24E-06 4.69E-07 mr1522_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112963070 NA 5.43E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251