\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112935039:

Variant ID: vg1112935039 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12935039
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTTAGTTCACGACAGTTGTACAAATGATACCCCGCATTTGGCAATAGGATTTCATTTGTACAACCGGGGAAAAAGTAAATCAAAGATCTGTCTACTCC[A/G]
TGTTTCAGAATATGCCCTTGCACTAGATAAGCCTCATCAATACACGGACGAGCGGCTGAGATAAAAGCAATTTGGTCGCTAACGACCCCTAGCCCTTTTG

Reverse complement sequence

CAAAAGGGCTAGGGGTCGTTAGCGACCAAATTGCTTTTATCTCAGCCGCTCGTCCGTGTATTGATGAGGCTTATCTAGTGCAAGGGCATATTCTGAAACA[T/C]
GGAGTAGACAGATCTTTGATTTACTTTTTCCCCGGTTGTACAAATGAAATCCTATTGCCAAATGCGGGGTATCATTTGTACAACTGTCGTGAACTAACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 3.50% 4.55% 4.59% NA
All Indica  2759 79.50% 6.00% 7.54% 7.00% NA
All Japonica  1512 98.30% 0.00% 0.26% 1.46% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 86.70% 3.00% 4.71% 5.55% NA
Indica II  465 78.50% 8.40% 8.39% 4.73% NA
Indica III  913 74.70% 7.10% 9.20% 8.98% NA
Indica Intermediate  786 80.20% 5.50% 7.25% 7.12% NA
Temperate Japonica  767 99.50% 0.00% 0.13% 0.39% NA
Tropical Japonica  504 96.40% 0.00% 0.00% 3.57% NA
Japonica Intermediate  241 98.30% 0.00% 1.24% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112935039 A -> DEL LOC_Os11g22500.1 N frameshift_variant Average:8.928; most accessible tissue: Callus, score: 23.752 N N N N
vg1112935039 A -> G LOC_Os11g22500.1 synonymous_variant ; p.His130His; LOW synonymous_codon Average:8.928; most accessible tissue: Callus, score: 23.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112935039 3.99E-06 7.23E-08 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 4.23E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 8.04E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 6.44E-09 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 4.09E-08 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 6.07E-07 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 5.88E-06 NA mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 2.04E-06 7.91E-08 mr1243 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 1.30E-08 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 3.73E-06 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 1.01E-08 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 3.06E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 2.88E-08 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 1.15E-08 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 4.64E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 1.10E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112935039 NA 1.54E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251