\
| Variant ID: vg1112935039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12935039 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGTTAGTTCACGACAGTTGTACAAATGATACCCCGCATTTGGCAATAGGATTTCATTTGTACAACCGGGGAAAAAGTAAATCAAAGATCTGTCTACTCC[A/G]
TGTTTCAGAATATGCCCTTGCACTAGATAAGCCTCATCAATACACGGACGAGCGGCTGAGATAAAAGCAATTTGGTCGCTAACGACCCCTAGCCCTTTTG
CAAAAGGGCTAGGGGTCGTTAGCGACCAAATTGCTTTTATCTCAGCCGCTCGTCCGTGTATTGATGAGGCTTATCTAGTGCAAGGGCATATTCTGAAACA[T/C]
GGAGTAGACAGATCTTTGATTTACTTTTTCCCCGGTTGTACAAATGAAATCCTATTGCCAAATGCGGGGTATCATTTGTACAACTGTCGTGAACTAACCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 3.50% | 4.55% | 4.59% | NA |
| All Indica | 2759 | 79.50% | 6.00% | 7.54% | 7.00% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 0.26% | 1.46% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 86.70% | 3.00% | 4.71% | 5.55% | NA |
| Indica II | 465 | 78.50% | 8.40% | 8.39% | 4.73% | NA |
| Indica III | 913 | 74.70% | 7.10% | 9.20% | 8.98% | NA |
| Indica Intermediate | 786 | 80.20% | 5.50% | 7.25% | 7.12% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 96.40% | 0.00% | 0.00% | 3.57% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112935039 | A -> DEL | LOC_Os11g22500.1 | N | frameshift_variant | Average:8.928; most accessible tissue: Callus, score: 23.752 | N | N | N | N |
| vg1112935039 | A -> G | LOC_Os11g22500.1 | synonymous_variant ; p.His130His; LOW | synonymous_codon | Average:8.928; most accessible tissue: Callus, score: 23.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112935039 | 3.99E-06 | 7.23E-08 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 4.23E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | 8.04E-06 | NA | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 6.44E-09 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 4.09E-08 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 6.07E-07 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | 5.88E-06 | NA | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | 2.04E-06 | 7.91E-08 | mr1243 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 1.30E-08 | mr1251 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 3.73E-06 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 1.01E-08 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 3.06E-07 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 2.88E-08 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 1.15E-08 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 4.64E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 1.10E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112935039 | NA | 1.54E-07 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |