\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112920702:

Variant ID: vg1112920702 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12920702
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAAGGTAGGATTATGGATGTCATTAGTTCTAGGCTTTCTACAGGATGAGAGACCCGAAATACTTTGTCAAAACATACGCTTGTTAAAATCAGGAAATG[C/T]
GTTCCTGAAATTAACTTTGCATGTTTTGTCAAAGACTAGAAGCAAGCTAAGTTCTTTCCAAGAAAGGTGATATTCCTTGCGGAATAACCGGAAAGTAACG

Reverse complement sequence

CGTTACTTTCCGGTTATTCCGCAAGGAATATCACCTTTCTTGGAAAGAACTTAGCTTGCTTCTAGTCTTTGACAAAACATGCAAAGTTAATTTCAGGAAC[G/A]
CATTTCCTGATTTTAACAAGCGTATGTTTTGACAAAGTATTTCGGGTCTCTCATCCTGTAGAAAGCCTAGAACTAATGACATCCATAATCCTACCTTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 0.10% 1.16% 6.79% NA
All Indica  2759 87.90% 0.30% 1.78% 10.08% NA
All Japonica  1512 98.10% 0.00% 0.07% 1.85% NA
Aus  269 98.10% 0.00% 0.74% 1.12% NA
Indica I  595 87.70% 0.00% 1.68% 10.59% NA
Indica II  465 77.20% 0.20% 3.23% 19.35% NA
Indica III  913 93.10% 0.30% 1.31% 5.26% NA
Indica Intermediate  786 88.30% 0.40% 1.53% 9.80% NA
Temperate Japonica  767 99.50% 0.00% 0.13% 0.39% NA
Tropical Japonica  504 95.60% 0.00% 0.00% 4.37% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 84.40% 0.00% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112920702 C -> T LOC_Os11g22480.1 downstream_gene_variant ; 1339.0bp to feature; MODIFIER silent_mutation Average:13.869; most accessible tissue: Callus, score: 40.284 N N N N
vg1112920702 C -> T LOC_Os11g22470.1 intron_variant ; MODIFIER silent_mutation Average:13.869; most accessible tissue: Callus, score: 40.284 N N N N
vg1112920702 C -> DEL N N silent_mutation Average:13.869; most accessible tissue: Callus, score: 40.284 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112920702 NA 8.49E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.20E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 5.58E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.89E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 2.30E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.73E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 4.98E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.47E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 3.83E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 7.74E-06 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.06E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.56E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 4.31E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.26E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 7.62E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 5.89E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 5.48E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 3.03E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 8.68E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.57E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 4.86E-08 mr1892_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112920702 NA 1.20E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251