\
| Variant ID: vg1112920702 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12920702 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTAAGGTAGGATTATGGATGTCATTAGTTCTAGGCTTTCTACAGGATGAGAGACCCGAAATACTTTGTCAAAACATACGCTTGTTAAAATCAGGAAATG[C/T]
GTTCCTGAAATTAACTTTGCATGTTTTGTCAAAGACTAGAAGCAAGCTAAGTTCTTTCCAAGAAAGGTGATATTCCTTGCGGAATAACCGGAAAGTAACG
CGTTACTTTCCGGTTATTCCGCAAGGAATATCACCTTTCTTGGAAAGAACTTAGCTTGCTTCTAGTCTTTGACAAAACATGCAAAGTTAATTTCAGGAAC[G/A]
CATTTCCTGATTTTAACAAGCGTATGTTTTGACAAAGTATTTCGGGTCTCTCATCCTGTAGAAAGCCTAGAACTAATGACATCCATAATCCTACCTTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 0.10% | 1.16% | 6.79% | NA |
| All Indica | 2759 | 87.90% | 0.30% | 1.78% | 10.08% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 0.07% | 1.85% | NA |
| Aus | 269 | 98.10% | 0.00% | 0.74% | 1.12% | NA |
| Indica I | 595 | 87.70% | 0.00% | 1.68% | 10.59% | NA |
| Indica II | 465 | 77.20% | 0.20% | 3.23% | 19.35% | NA |
| Indica III | 913 | 93.10% | 0.30% | 1.31% | 5.26% | NA |
| Indica Intermediate | 786 | 88.30% | 0.40% | 1.53% | 9.80% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 0.00% | 4.37% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 84.40% | 0.00% | 3.33% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112920702 | C -> T | LOC_Os11g22480.1 | downstream_gene_variant ; 1339.0bp to feature; MODIFIER | silent_mutation | Average:13.869; most accessible tissue: Callus, score: 40.284 | N | N | N | N |
| vg1112920702 | C -> T | LOC_Os11g22470.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.869; most accessible tissue: Callus, score: 40.284 | N | N | N | N |
| vg1112920702 | C -> DEL | N | N | silent_mutation | Average:13.869; most accessible tissue: Callus, score: 40.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112920702 | NA | 8.49E-08 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.20E-09 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 5.58E-09 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.89E-06 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 2.30E-06 | mr1479 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.73E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 4.98E-09 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.47E-08 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 3.83E-07 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 7.74E-06 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.06E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.56E-09 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 4.31E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.26E-09 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 7.62E-06 | mr1042_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 5.89E-09 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 5.48E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 3.03E-06 | mr1479_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 8.68E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.57E-06 | mr1892_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 4.86E-08 | mr1892_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112920702 | NA | 1.20E-06 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |