Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112909023:

Variant ID: vg1112909023 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12909023
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CAATACTTCGTGACATGGGACCATCCAAACGGTCAACCGAACCGGCGAACGGAACCGACGGCTCAGACACGGTTTACGACAGAGACTCGGTACAGCAAGC[G/A]
ATAGGCCGGTAGGGGTTTAGGGATGCACCTATGGCTTTGCGACTCGGCTACTGAGCTACGGGCAGCGGCAAACCACGACAGCTAGGCGGTGACACAAGGC

Reverse complement sequence

GCCTTGTGTCACCGCCTAGCTGTCGTGGTTTGCCGCTGCCCGTAGCTCAGTAGCCGAGTCGCAAAGCCATAGGTGCATCCCTAAACCCCTACCGGCCTAT[C/T]
GCTTGCTGTACCGAGTCTCTGTCGTAAACCGTGTCTGAGCCGTCGGTTCCGTTCGCCGGTTCGGTTGACCGTTTGGATGGTCCCATGTCACGAAGTATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.20%	31.50%	0.28%	26.01%	NA
All Indica	2759	15.30%	41.80%	0.47%	42.44%	NA
All Japonica	1512	95.50%	1.60%	0.00%	2.91%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	38.80%	19.50%	0.84%	40.84%	NA
Indica II	465	9.90%	64.10%	0.43%	25.59%	NA
Indica III	913	1.90%	41.40%	0.33%	56.41%	NA
Indica Intermediate	786	16.20%	46.10%	0.38%	37.40%	NA
Temperate Japonica	767	96.90%	2.10%	0.00%	1.04%	NA
Tropical Japonica	504	92.50%	1.20%	0.00%	6.35%	NA
Japonica Intermediate	241	97.50%	0.80%	0.00%	1.66%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	48.90%	35.60%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112909023	G -> A	LOC_Os11g22460.1	upstream_gene_variant ; 1547.0bp to feature; MODIFIER	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg1112909023	G -> A	LOC_Os11g22449.1	downstream_gene_variant ; 3530.0bp to feature; MODIFIER	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg1112909023	G -> A	LOC_Os11g22460-LOC_Os11g22470	intergenic_region ; MODIFIER	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N
vg1112909023	G -> DEL	N	N	silent_mutation	Average:44.199; most accessible tissue: Zhenshan97 young leaf, score: 76.44	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112909023	8.55E-06	NA	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	1.44E-06	NA	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	2.03E-06	NA	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	2.86E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	6.78E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	2.54E-06	NA	mr1077	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	3.57E-06	3.15E-10	mr1077	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	2.72E-06	NA	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	2.14E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	1.62E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	2.55E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	1.55E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	4.82E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	4.51E-08	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	1.85E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	6.29E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	1.45E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	8.09E-09	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	4.99E-06	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	2.74E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	5.07E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	3.29E-08	NA	mr1795	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	1.41E-08	1.99E-08	mr1795	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	2.07E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	4.50E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112909023	NA	1.02E-06	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251