Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112908978:

Variant ID: vg1112908978 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12908978
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TAAACCTCTGGTAAGCAAGCCTCATGAATTAACGACTCAACGACCCAATACTTCGTGACATGGGACCATCCAAACGGTCAACCGAACCGGCGAACGGAAC[C/T]
GACGGCTCAGACACGGTTTACGACAGAGACTCGGTACAGCAAGCGATAGGCCGGTAGGGGTTTAGGGATGCACCTATGGCTTTGCGACTCGGCTACTGAG

Reverse complement sequence

CTCAGTAGCCGAGTCGCAAAGCCATAGGTGCATCCCTAAACCCCTACCGGCCTATCGCTTGCTGTACCGAGTCTCTGTCGTAAACCGTGTCTGAGCCGTC[G/A]
GTTCCGTTCGCCGGTTCGGTTGACCGTTTGGATGGTCCCATGTCACGAAGTATTGGGTCGTTGAGTCGTTAATTCATGAGGCTTGCTTACCAGAGGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	31.40%	0.32%	26.03%	NA
All Indica	2759	15.40%	41.60%	0.54%	42.48%	NA
All Japonica	1512	95.50%	1.60%	0.00%	2.91%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	39.20%	19.20%	0.84%	40.84%	NA
Indica II	465	9.70%	63.90%	0.65%	25.81%	NA
Indica III	913	2.00%	41.20%	0.33%	56.52%	NA
Indica Intermediate	786	16.30%	45.90%	0.51%	37.28%	NA
Temperate Japonica	767	97.00%	2.10%	0.00%	0.91%	NA
Tropical Japonica	504	92.30%	1.20%	0.00%	6.55%	NA
Japonica Intermediate	241	97.50%	0.80%	0.00%	1.66%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	48.90%	35.60%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112908978	C -> T	LOC_Os11g22460.1	upstream_gene_variant ; 1502.0bp to feature; MODIFIER	silent_mutation	Average:41.677; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1112908978	C -> T	LOC_Os11g22449.1	downstream_gene_variant ; 3485.0bp to feature; MODIFIER	silent_mutation	Average:41.677; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1112908978	C -> T	LOC_Os11g22460-LOC_Os11g22470	intergenic_region ; MODIFIER	silent_mutation	Average:41.677; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg1112908978	C -> DEL	N	N	silent_mutation	Average:41.677; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112908978	8.60E-06	NA	mr1053	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	2.47E-07	NA	mr1067	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	2.70E-07	NA	mr1067	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.92E-06	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	3.18E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	4.02E-06	NA	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	4.39E-06	8.33E-10	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	6.47E-07	NA	mr1080	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	8.67E-07	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	5.24E-06	mr1202	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	9.60E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	4.61E-09	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.12E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	8.09E-06	NA	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	2.99E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.28E-08	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.41E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.03E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.38E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.63E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	8.06E-06	mr1771	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	6.47E-08	NA	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	2.36E-08	4.07E-08	mr1795	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	7.81E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.38E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.09E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112908978	NA	1.10E-06	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251