\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112894682:

Variant ID: vg1112894682 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12894682
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTTGCGGTTCGGTTTGTTGCAGTTCTACATTTGGGCAAATTTACAGTGCTTCAGTTTTTCGATGTTTCGGGGCTCTAAATGCTATTTTCTGCAAAAGT[G/A]
TATACTAGGAAGATGTAGATAATGTTTGGATCTATCTTCTGACCAAAGGGCGTGATTTTATCTCAAGTGGTTTAGGAGATATAATTTTTTTAGTATGACT

Reverse complement sequence

AGTCATACTAAAAAAATTATATCTCCTAAACCACTTGAGATAAAATCACGCCCTTTGGTCAGAAGATAGATCCAAACATTATCTACATCTTCCTAGTATA[C/T]
ACTTTTGCAGAAAATAGCATTTAGAGCCCCGAAACATCGAAAAACTGAAGCACTGTAAATTTGCCCAAATGTAGAACTGCAACAAACCGAACCGCAAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 19.60% 0.55% 26.01% NA
All Indica  2759 33.10% 23.60% 0.94% 42.41% NA
All Japonica  1512 96.60% 0.50% 0.00% 2.91% NA
Aus  269 14.50% 85.50% 0.00% 0.00% NA
Indica I  595 51.40% 4.70% 1.85% 42.02% NA
Indica II  465 16.30% 56.80% 0.43% 26.45% NA
Indica III  913 29.10% 14.90% 0.66% 55.31% NA
Indica Intermediate  786 33.60% 28.40% 0.89% 37.15% NA
Temperate Japonica  767 98.70% 0.30% 0.00% 1.04% NA
Tropical Japonica  504 93.10% 0.60% 0.00% 6.35% NA
Japonica Intermediate  241 97.50% 0.80% 0.00% 1.66% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 53.30% 30.00% 0.00% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112894682 G -> A LOC_Os11g22440-LOC_Os11g22449 intergenic_region ; MODIFIER silent_mutation Average:24.968; most accessible tissue: Zhenshan97 young leaf, score: 45.281 N N N N
vg1112894682 G -> DEL N N silent_mutation Average:24.968; most accessible tissue: Zhenshan97 young leaf, score: 45.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112894682 NA 3.45E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 5.83E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 5.21E-06 5.02E-10 mr1277 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 6.39E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 1.16E-07 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 1.50E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 3.32E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 1.16E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 5.01E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 1.39E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 5.17E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 8.40E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 6.75E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 6.33E-11 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 6.51E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 8.24E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 1.46E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112894682 NA 1.57E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251