Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112889066:

Variant ID: vg1112889066 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12889066
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTGCTATGTTTTATATCTCTTATATATGGGTTCATAGGTAAGTGCTCTCTCAAAGGCTAAATATGAGTAGCCAACAATTATCCAAGAACCTGAGGTAA[A/C]
TGAGCTGCACTTGCTGATCTAAGTCTAAGTTGTTGTGAGATATGAGATAGTAAATATGAGTTGCTATGATCCTGATACTAGTTTGACGTGAATTCCAGAT

Reverse complement sequence

ATCTGGAATTCACGTCAAACTAGTATCAGGATCATAGCAACTCATATTTACTATCTCATATCTCACAACAACTTAGACTTAGATCAGCAAGTGCAGCTCA[T/G]
TTACCTCAGGTTCTTGGATAATTGTTGGCTACTCATATTTAGCCTTTGAGAGAGCACTTACCTATGAACCCATATATAAGAGATATAAAACATAGCAACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.60%	1.60%	5.29%	20.50%	NA
All Indica	2759	54.40%	2.70%	8.92%	34.00%	NA
All Japonica	1512	98.80%	0.00%	0.13%	1.06%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	27.40%	4.20%	9.24%	59.16%	NA
Indica II	465	69.90%	0.90%	6.45%	22.80%	NA
Indica III	913	56.50%	3.20%	10.73%	29.57%	NA
Indica Intermediate	786	63.10%	2.20%	8.02%	26.72%	NA
Temperate Japonica	767	99.00%	0.00%	0.00%	1.04%	NA
Tropical Japonica	504	98.60%	0.00%	0.20%	1.19%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	0.00%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112889066	A -> DEL	N	N	silent_mutation	Average:17.878; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1112889066	A -> C	LOC_Os11g22440.1	downstream_gene_variant ; 29.0bp to feature; MODIFIER	silent_mutation	Average:17.878; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1112889066	A -> C	LOC_Os11g22440-LOC_Os11g22449	intergenic_region ; MODIFIER	silent_mutation	Average:17.878; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112889066	6.08E-06	NA	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	1.61E-06	1.35E-06	mr1089	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	1.69E-08	NA	mr1109	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	2.57E-07	2.02E-09	mr1109	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	8.89E-06	NA	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	NA	7.21E-07	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	1.97E-07	NA	mr1251	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	8.40E-07	1.25E-07	mr1251	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	NA	7.51E-06	mr1253	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	1.39E-09	NA	mr1255	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	8.66E-08	1.72E-08	mr1255	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	1.79E-07	NA	mr1257	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	1.30E-06	1.33E-08	mr1257	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	NA	9.91E-06	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	7.54E-07	NA	mr1435	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	2.40E-06	1.94E-07	mr1435	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	5.16E-07	NA	mr1599	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	5.23E-07	1.68E-07	mr1599	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	NA	7.58E-08	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066	NA	8.96E-09	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251