\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112889066:

Variant ID: vg1112889066 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12889066
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTGCTATGTTTTATATCTCTTATATATGGGTTCATAGGTAAGTGCTCTCTCAAAGGCTAAATATGAGTAGCCAACAATTATCCAAGAACCTGAGGTAA[A/C]
TGAGCTGCACTTGCTGATCTAAGTCTAAGTTGTTGTGAGATATGAGATAGTAAATATGAGTTGCTATGATCCTGATACTAGTTTGACGTGAATTCCAGAT

Reverse complement sequence

ATCTGGAATTCACGTCAAACTAGTATCAGGATCATAGCAACTCATATTTACTATCTCATATCTCACAACAACTTAGACTTAGATCAGCAAGTGCAGCTCA[T/G]
TTACCTCAGGTTCTTGGATAATTGTTGGCTACTCATATTTAGCCTTTGAGAGAGCACTTACCTATGAACCCATATATAAGAGATATAAAACATAGCAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 1.60% 5.29% 20.50% NA
All Indica  2759 54.40% 2.70% 8.92% 34.00% NA
All Japonica  1512 98.80% 0.00% 0.13% 1.06% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 27.40% 4.20% 9.24% 59.16% NA
Indica II  465 69.90% 0.90% 6.45% 22.80% NA
Indica III  913 56.50% 3.20% 10.73% 29.57% NA
Indica Intermediate  786 63.10% 2.20% 8.02% 26.72% NA
Temperate Japonica  767 99.00% 0.00% 0.00% 1.04% NA
Tropical Japonica  504 98.60% 0.00% 0.20% 1.19% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 0.00% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112889066 A -> DEL N N silent_mutation Average:17.878; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1112889066 A -> C LOC_Os11g22440.1 downstream_gene_variant ; 29.0bp to feature; MODIFIER silent_mutation Average:17.878; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1112889066 A -> C LOC_Os11g22440-LOC_Os11g22449 intergenic_region ; MODIFIER silent_mutation Average:17.878; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112889066 6.08E-06 NA mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 1.61E-06 1.35E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 1.69E-08 NA mr1109 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 2.57E-07 2.02E-09 mr1109 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 8.89E-06 NA mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 NA 7.21E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 1.97E-07 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 8.40E-07 1.25E-07 mr1251 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 NA 7.51E-06 mr1253 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 1.39E-09 NA mr1255 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 8.66E-08 1.72E-08 mr1255 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 1.79E-07 NA mr1257 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 1.30E-06 1.33E-08 mr1257 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 NA 9.91E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 7.54E-07 NA mr1435 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 2.40E-06 1.94E-07 mr1435 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 5.16E-07 NA mr1599 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 5.23E-07 1.68E-07 mr1599 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 NA 7.58E-08 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112889066 NA 8.96E-09 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251