\
| Variant ID: vg1112762176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12762176 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 117. )
TGATAAAAGGAAATTATCATTATTATGGATCAATATAATTGTCAGATAAGAACACAGAAGGACTGCGAGTGTTCCATCTTTATGCAAACAAGGAATGTAA[G/T]
GACAAGCATCATCATGGTTTTCTCTTTCTTTTTAGTGATGCTAAGGGAGAATCATCTAGTATGTCTTCTTCATTGCCATCATCTTGCTCAACTTCAGTGC
GCACTGAAGTTGAGCAAGATGATGGCAATGAAGAAGACATACTAGATGATTCTCCCTTAGCATCACTAAAAAGAAAGAGAAAACCATGATGATGCTTGTC[C/A]
TTACATTCCTTGTTTGCATAAAGATGGAACACTCGCAGTCCTTCTGTGTTCTTATCTGACAATTATATTGATCCATAATAATGATAATTTCCTTTTATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.30% | 19.00% | 0.97% | 39.70% | NA |
| All Indica | 2759 | 12.30% | 22.60% | 1.45% | 63.65% | NA |
| All Japonica | 1512 | 95.30% | 0.40% | 0.13% | 4.17% | NA |
| Aus | 269 | 1.10% | 86.60% | 1.49% | 10.78% | NA |
| Indica I | 595 | 11.80% | 2.20% | 2.18% | 83.87% | NA |
| Indica II | 465 | 3.20% | 56.60% | 0.65% | 39.57% | NA |
| Indica III | 913 | 15.90% | 14.50% | 1.64% | 68.02% | NA |
| Indica Intermediate | 786 | 13.90% | 27.50% | 1.15% | 57.51% | NA |
| Temperate Japonica | 767 | 96.60% | 0.30% | 0.13% | 3.00% | NA |
| Tropical Japonica | 504 | 92.10% | 0.60% | 0.20% | 7.14% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 88.50% | 9.40% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 42.20% | 28.90% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112762176 | G -> T | LOC_Os11g22230.1 | downstream_gene_variant ; 3876.0bp to feature; MODIFIER | silent_mutation | Average:13.031; most accessible tissue: Callus, score: 26.928 | N | N | N | N |
| vg1112762176 | G -> T | LOC_Os11g22240.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.031; most accessible tissue: Callus, score: 26.928 | N | N | N | N |
| vg1112762176 | G -> DEL | N | N | silent_mutation | Average:13.031; most accessible tissue: Callus, score: 26.928 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112762176 | 1.61E-06 | 1.05E-09 | mr1277 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 6.75E-07 | mr1609 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 1.08E-08 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 2.97E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 2.10E-10 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 2.32E-07 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 3.75E-08 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 2.01E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 3.32E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 1.52E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 2.89E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 4.22E-10 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 5.24E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112762176 | NA | 1.06E-09 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |