\
| Variant ID: vg1112717844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12717844 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.28, others allele: 0.00, population size: 213. )
TCAGTGGCCCACCTCTCATCCGCAATATATAACCCTAAATAATGATATCCCGTAATCTAGACACCACGCCTAAACTACCAGATACTACTCTAATATCATC[G/A]
TTATGACATAGAATAATTGCATAAGCAAACATTATACCCGCACCAAAGCATGTCCCAGATAAGCTAGCCGTATATTCAGTATAACATGAACATAATGTAA
TTACATTATGTTCATGTTATACTGAATATACGGCTAGCTTATCTGGGACATGCTTTGGTGCGGGTATAATGTTTGCTTATGCAATTATTCTATGTCATAA[C/T]
GATGATATTAGAGTAGTATCTGGTAGTTTAGGCGTGGTGTCTAGATTACGGGATATCATTATTTAGGGTTATATATTGCGGATGAGAGGTGGGCCACTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 37.10% | 1.50% | 0.53% | NA |
| All Indica | 2759 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 94.80% | 0.07% | 1.65% | NA |
| Aus | 269 | 30.50% | 48.30% | 21.19% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 0.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.10% | 5.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.60% | 91.30% | 0.20% | 4.96% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 93.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 36.70% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112717844 | G -> A | LOC_Os11g22170.1 | downstream_gene_variant ; 4640.0bp to feature; MODIFIER | silent_mutation | Average:53.799; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg1112717844 | G -> A | LOC_Os11g22160.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.799; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg1112717844 | G -> DEL | N | N | silent_mutation | Average:53.799; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112717844 | NA | 1.85E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 4.95E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 1.31E-09 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 4.01E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | 4.36E-06 | NA | mr1684 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 7.24E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 1.29E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 5.47E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112717844 | NA | 3.61E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |