| Variant ID: vg1112695068 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12695068 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 117. )
TGAGGCCCGCTTGCCAGATCAATCTAAGCCATCCAATCTTGGTCGACTCGGTCAAGATTAATCTCAGCCATATAAATCCGTTCGCTCTTTTCAGTGGCAT[T/A]
TTATTTCTTTTTAATATATGTCATCTACCAAATATAATCTAATCTATTTCGGAGGTTGCTTTAATCTTTTATCTCAGTTATAAATCATTTGTAAATTATT
AATAATTTACAAATGATTTATAACTGAGATAAAAGATTAAAGCAACCTCCGAAATAGATTAGATTATATTTGGTAGATGACATATATTAAAAAGAAATAA[A/T]
ATGCCACTGAAAAGAGCGAACGGATTTATATGGCTGAGATTAATCTTGACCGAGTCGACCAAGATTGGATGGCTTAGATTGATCTGGCAAGCGGGCCTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.70% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 5.10% | 94.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 8.30% | 91.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112695068 | T -> A | LOC_Os11g22110.1 | upstream_gene_variant ; 2695.0bp to feature; MODIFIER | silent_mutation | Average:40.672; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1112695068 | T -> A | LOC_Os11g22120.1 | upstream_gene_variant ; 1310.0bp to feature; MODIFIER | silent_mutation | Average:40.672; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1112695068 | T -> A | LOC_Os11g22100.1 | downstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:40.672; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1112695068 | T -> A | LOC_Os11g22130.1 | downstream_gene_variant ; 3566.0bp to feature; MODIFIER | silent_mutation | Average:40.672; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| vg1112695068 | T -> A | LOC_Os11g22120-LOC_Os11g22130 | intergenic_region ; MODIFIER | silent_mutation | Average:40.672; most accessible tissue: Minghui63 young leaf, score: 54.11 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112695068 | NA | 2.93E-75 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 1.89E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 3.08E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 4.96E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 2.09E-85 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | 6.54E-12 | 8.81E-113 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | 2.06E-07 | 2.06E-07 | mr1758 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 2.35E-37 | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 1.87E-98 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 3.13E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | 1.23E-11 | 5.74E-161 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112695068 | NA | 8.88E-10 | mr1758_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |