Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112669284:

Variant ID: vg1112669284 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12669284
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGCAGGAATAGGGTTGATCTGCACCGGCAAAATCAACTACCCACGGAGAGGTGTATCGATCGCTAAGGTGCAACGCAACGTCTTGTACGATTGTAGTC[G/A]
GATCATCAACGTTTCTCCCAAATCGTAGTTATCTCAACTCACCGAAAGATCGGCCAACAACAGCCTTGAGTGTCGAGTGGAATTCAGGGTTCATCAGGTG

Reverse complement sequence

CACCTGATGAACCCTGAATTCCACTCGACACTCAAGGCTGTTGTTGGCCGATCTTTCGGTGAGTTGAGATAACTACGATTTGGGAGAAACGTTGATGATC[C/T]
GACTACAATCGTACAAGACGTTGCGTTGCACCTTAGCGATCGATACACCTCTCCGTGGGTAGTTGATTTTGCCGGTGCAGATCAACCCTATTCCTGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	42.70%	0.32%	0.00%	NA
All Indica	2759	32.50%	67.00%	0.47%	0.00%	NA
All Japonica	1512	94.20%	5.70%	0.07%	0.00%	NA
Aus	269	87.70%	12.30%	0.00%	0.00%	NA
Indica I	595	10.30%	89.70%	0.00%	0.00%	NA
Indica II	465	58.10%	41.30%	0.65%	0.00%	NA
Indica III	913	28.40%	70.90%	0.77%	0.00%	NA
Indica Intermediate	786	39.10%	60.60%	0.38%	0.00%	NA
Temperate Japonica	767	96.70%	3.30%	0.00%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	2.90%	0.41%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112669284	G -> A	LOC_Os11g22040.1	upstream_gene_variant ; 4964.0bp to feature; MODIFIER	silent_mutation	Average:53.716; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg1112669284	G -> A	LOC_Os11g22030.1	intron_variant ; MODIFIER	silent_mutation	Average:53.716; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112669284	NA	1.67E-06	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	8.28E-07	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	7.94E-08	mr1504	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	2.06E-11	mr1609	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	4.87E-06	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	1.28E-08	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	1.70E-07	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	1.86E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	1.63E-06	1.16E-10	mr1134_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	4.75E-08	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	8.09E-09	mr1504_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	5.62E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	1.11E-06	1.83E-09	mr1758_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112669284	NA	1.68E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251