| Variant ID: vg1112020874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 12020874 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.37, others allele: 0.00, population size: 222. )
CCTTAGCATCGGCTAACCAACCCAAATAATTAGCCGTTATGCCTTAGCATCGGCTAACCAACTCCAAATATCTAGCCATCGTGCTACTCTACTCTAGCAC[C/T]
GACTAGAAAACCAAATCCACCGAATAAACCTCACCTATCCAAAATTATCCTTTCTTTGATTTTATTCAATTTCCAACCTATAAAAACCATCACCTCTCTT
AAGAGAGGTGATGGTTTTTATAGGTTGGAAATTGAATAAAATCAAAGAAAGGATAATTTTGGATAGGTGAGGTTTATTCGGTGGATTTGGTTTTCTAGTC[G/A]
GTGCTAGAGTAGAGTAGCACGATGGCTAGATATTTGGAGTTGGTTAGCCGATGCTAAGGCATAACGGCTAATTATTTGGGTTGGTTAGCCGATGCTAAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 6.00% | 94.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.00% | 2.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 4.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 11.30% | 88.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1112020874 | C -> T | LOC_Os11g20760.1 | upstream_gene_variant ; 1369.0bp to feature; MODIFIER | silent_mutation | Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| vg1112020874 | C -> T | LOC_Os11g20770.1 | upstream_gene_variant ; 287.0bp to feature; MODIFIER | silent_mutation | Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| vg1112020874 | C -> T | LOC_Os11g20780.1 | upstream_gene_variant ; 2738.0bp to feature; MODIFIER | silent_mutation | Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| vg1112020874 | C -> T | LOC_Os11g20760-LOC_Os11g20770 | intergenic_region ; MODIFIER | silent_mutation | Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1112020874 | NA | 2.52E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | NA | 5.78E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | NA | 5.14E-18 | mr1529 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | NA | 1.16E-11 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | NA | 6.65E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | 1.41E-07 | 7.70E-102 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | NA | 5.99E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | 1.37E-08 | 2.03E-141 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1112020874 | 8.70E-07 | 2.11E-09 | mr1758_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |