\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112020874:

Variant ID: vg1112020874 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 12020874
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.37, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTAGCATCGGCTAACCAACCCAAATAATTAGCCGTTATGCCTTAGCATCGGCTAACCAACTCCAAATATCTAGCCATCGTGCTACTCTACTCTAGCAC[C/T]
GACTAGAAAACCAAATCCACCGAATAAACCTCACCTATCCAAAATTATCCTTTCTTTGATTTTATTCAATTTCCAACCTATAAAAACCATCACCTCTCTT

Reverse complement sequence

AAGAGAGGTGATGGTTTTTATAGGTTGGAAATTGAATAAAATCAAAGAAAGGATAATTTTGGATAGGTGAGGTTTATTCGGTGGATTTGGTTTTCTAGTC[G/A]
GTGCTAGAGTAGAGTAGCACGATGGCTAGATATTTGGAGTTGGTTAGCCGATGCTAAGGCATAACGGCTAATTATTTGGGTTGGTTAGCCGATGCTAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.50% 0.08% 0.00% NA
All Indica  2759 97.90% 2.00% 0.11% 0.00% NA
All Japonica  1512 6.00% 94.00% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 97.00% 2.90% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.20% 0.25% 0.00% NA
Temperate Japonica  767 3.30% 96.60% 0.13% 0.00% NA
Tropical Japonica  504 11.30% 88.70% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1112020874 C -> T LOC_Os11g20760.1 upstream_gene_variant ; 1369.0bp to feature; MODIFIER silent_mutation Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg1112020874 C -> T LOC_Os11g20770.1 upstream_gene_variant ; 287.0bp to feature; MODIFIER silent_mutation Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg1112020874 C -> T LOC_Os11g20780.1 upstream_gene_variant ; 2738.0bp to feature; MODIFIER silent_mutation Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg1112020874 C -> T LOC_Os11g20760-LOC_Os11g20770 intergenic_region ; MODIFIER silent_mutation Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1112020874 NA 2.52E-21 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 NA 5.78E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 NA 5.14E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 NA 1.16E-11 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 NA 6.65E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 1.41E-07 7.70E-102 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 NA 5.99E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 1.37E-08 2.03E-141 mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874 8.70E-07 2.11E-09 mr1758_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251