Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1112020874:

Variant ID: vg1112020874 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12020874
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.64, T: 0.37, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTAGCATCGGCTAACCAACCCAAATAATTAGCCGTTATGCCTTAGCATCGGCTAACCAACTCCAAATATCTAGCCATCGTGCTACTCTACTCTAGCAC[C/T]
GACTAGAAAACCAAATCCACCGAATAAACCTCACCTATCCAAAATTATCCTTTCTTTGATTTTATTCAATTTCCAACCTATAAAAACCATCACCTCTCTT

Reverse complement sequence

AAGAGAGGTGATGGTTTTTATAGGTTGGAAATTGAATAAAATCAAAGAAAGGATAATTTTGGATAGGTGAGGTTTATTCGGTGGATTTGGTTTTCTAGTC[G/A]
GTGCTAGAGTAGAGTAGCACGATGGCTAGATATTTGGAGTTGGTTAGCCGATGCTAAGGCATAACGGCTAATTATTTGGGTTGGTTAGCCGATGCTAAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.50%	33.50%	0.08%	0.00%	NA
All Indica	2759	97.90%	2.00%	0.11%	0.00%	NA
All Japonica	1512	6.00%	94.00%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	97.00%	2.90%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.50%	4.20%	0.25%	0.00%	NA
Temperate Japonica	767	3.30%	96.60%	0.13%	0.00%	NA
Tropical Japonica	504	11.30%	88.70%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112020874	C -> T	LOC_Os11g20760.1	upstream_gene_variant ; 1369.0bp to feature; MODIFIER	silent_mutation	Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1112020874	C -> T	LOC_Os11g20770.1	upstream_gene_variant ; 287.0bp to feature; MODIFIER	silent_mutation	Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1112020874	C -> T	LOC_Os11g20780.1	upstream_gene_variant ; 2738.0bp to feature; MODIFIER	silent_mutation	Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg1112020874	C -> T	LOC_Os11g20760-LOC_Os11g20770	intergenic_region ; MODIFIER	silent_mutation	Average:34.585; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112020874	NA	2.52E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	NA	5.78E-24	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	NA	5.14E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	NA	1.16E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	NA	6.65E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	1.41E-07	7.70E-102	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	NA	5.99E-22	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	1.37E-08	2.03E-141	mr1758_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112020874	8.70E-07	2.11E-09	mr1758_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251