\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111961036:

Variant ID: vg1111961036 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11961036
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTCAGGATTGACCTTTCAATTGCATCTTAGACTTTTGCATGGTCTACAACCGGTAATAATCTTCTGGTAATATCTACATTTCAGGTGACCAGAGACCA[T/G]
AACATATGCAAGGCATAGACTTTTGTATACTTTGGCATGCTGTAGACTTTGGCTGGTTCTGAAACATATAGTCATGAGGTAACCTATCTGATTATTAAGT

Reverse complement sequence

ACTTAATAATCAGATAGGTTACCTCATGACTATATGTTTCAGAACCAGCCAAAGTCTACAGCATGCCAAAGTATACAAAAGTCTATGCCTTGCATATGTT[A/C]
TGGTCTCTGGTCACCTGAAATGTAGATATTACCAGAAGATTATTACCGGTTGTAGACCATGCAAAAGTCTAAGATGCAATTGAAAGGTCAATCCTGAGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 34.30% 0.28% 22.18% NA
All Indica  2759 68.70% 2.50% 0.47% 28.31% NA
All Japonica  1512 5.00% 94.60% 0.00% 0.40% NA
Aus  269 13.40% 1.50% 0.00% 85.13% NA
Indica I  595 89.20% 3.20% 0.34% 7.23% NA
Indica II  465 44.30% 2.40% 0.86% 52.47% NA
Indica III  913 72.20% 0.70% 0.55% 26.62% NA
Indica Intermediate  786 63.50% 4.30% 0.25% 31.93% NA
Temperate Japonica  767 3.80% 96.00% 0.00% 0.26% NA
Tropical Japonica  504 8.30% 91.10% 0.00% 0.60% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 5.20% 85.40% 0.00% 9.38% NA
Intermediate  90 35.60% 38.90% 0.00% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111961036 T -> DEL N N silent_mutation Average:40.357; most accessible tissue: Callus, score: 84.918 N N N N
vg1111961036 T -> G LOC_Os11g20640.1 downstream_gene_variant ; 95.0bp to feature; MODIFIER silent_mutation Average:40.357; most accessible tissue: Callus, score: 84.918 N N N N
vg1111961036 T -> G LOC_Os11g20620-LOC_Os11g20640 intergenic_region ; MODIFIER silent_mutation Average:40.357; most accessible tissue: Callus, score: 84.918 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111961036 NA 6.69E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 1.58E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 6.03E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 3.88E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 9.30E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 3.40E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 3.43E-08 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 3.12E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 6.76E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 2.89E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 5.96E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 1.87E-06 7.95E-10 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 5.53E-07 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 2.56E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 6.54E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111961036 NA 7.30E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251