\
| Variant ID: vg1111945410 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 11945410 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 107. )
GTGTTTTTACTATAAACAGAAAAATCCTTAATTGAATTATTGCGCAATAAATAAATCCCGGGAGAGAGAGAGGGGCGGCGCCGACATGCGGGCCCCACAT[G/A]
GCAGTGACTCGGGGGGGCGGTTCACGGTGGACCGAGTCCACGGACCGGGGAAGGCGCGGTGCACCATGTGGCGCTGACGTGGCGCCGACGCGGCGGCCAC
GTGGCCGCCGCGTCGGCGCCACGTCAGCGCCACATGGTGCACCGCGCCTTCCCCGGTCCGTGGACTCGGTCCACCGTGAACCGCCCCCCCGAGTCACTGC[C/T]
ATGTGGGGCCCGCATGTCGGCGCCGCCCCTCTCTCTCTCCCGGGATTTATTTATTGCGCAATAATTCAATTAAGGATTTTTCTGTTTATAGTAAAAACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.50% | 20.50% | 32.04% | 0.00% | NA |
| All Indica | 2759 | 23.50% | 27.20% | 49.29% | 0.00% | NA |
| All Japonica | 1512 | 95.60% | 1.90% | 2.58% | 0.00% | NA |
| Aus | 269 | 8.60% | 58.70% | 32.71% | 0.00% | NA |
| Indica I | 595 | 18.50% | 17.50% | 64.03% | 0.00% | NA |
| Indica II | 465 | 20.60% | 26.70% | 52.69% | 0.00% | NA |
| Indica III | 913 | 27.50% | 33.60% | 38.88% | 0.00% | NA |
| Indica Intermediate | 786 | 24.30% | 27.50% | 48.22% | 0.00% | NA |
| Temperate Japonica | 767 | 96.70% | 1.00% | 2.22% | 0.00% | NA |
| Tropical Japonica | 504 | 92.90% | 3.40% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 8.30% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 25.60% | 27.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1111945410 | G -> A | LOC_Os11g20610.1 | downstream_gene_variant ; 1235.0bp to feature; MODIFIER | silent_mutation | Average:46.409; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| vg1111945410 | G -> A | LOC_Os11g20600-LOC_Os11g20610 | intergenic_region ; MODIFIER | silent_mutation | Average:46.409; most accessible tissue: Minghui63 young leaf, score: 70.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1111945410 | NA | 1.16E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 2.37E-08 | mr1829 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 5.24E-06 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 1.47E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 5.44E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 1.08E-11 | mr1806_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 7.33E-07 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 2.81E-09 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111945410 | NA | 1.44E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |