\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111934896:

Variant ID: vg1111934896 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11934896
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCGCTAAGTGCTCCTCAAAGTATGGGCCAACTTCTGTCATATGTTGGAGCACAGCGTAATGAGCCTGCGCGTACGACGCTTGATCGGGCTTAATTC[T/C]
TTTCCTTCCGATTGTGCCAACACCTGACAACCTTCCCTCGTGACGAGACGCTGGAACTCCGATAGGATCGGCATCGGACATGTAATTGACACAGAACTCA

Reverse complement sequence

TGAGTTCTGTGTCAATTACATGTCCGATGCCGATCCTATCGGAGTTCCAGCGTCTCGTCACGAGGGAAGGTTGTCAGGTGTTGGCACAATCGGAAGGAAA[A/G]
GAATTAAGCCCGATCAAGCGTCGTACGCGCAGGCTCATTACGCTGTGCTCCAACATATGACAGAAGTTGGCCCATACTTTGAGGAGCACTTAGCGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.40% 1.40% 6.31% 6.92% NA
All Indica  2759 76.10% 2.30% 10.29% 11.27% NA
All Japonica  1512 98.70% 0.00% 0.53% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 59.70% 4.40% 14.45% 21.51% NA
Indica II  465 82.80% 1.50% 5.38% 10.32% NA
Indica III  913 81.30% 1.10% 10.51% 7.12% NA
Indica Intermediate  786 78.60% 2.70% 9.80% 8.91% NA
Temperate Japonica  767 99.10% 0.00% 0.52% 0.39% NA
Tropical Japonica  504 98.20% 0.00% 0.40% 1.39% NA
Japonica Intermediate  241 98.80% 0.00% 0.83% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 87.80% 0.00% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111934896 T -> DEL LOC_Os11g20590.1 N frameshift_variant Average:7.648; most accessible tissue: Minghui63 flag leaf, score: 12.986 N N N N
vg1111934896 T -> C LOC_Os11g20590.1 missense_variant ; p.Arg689Gly; MODERATE nonsynonymous_codon ; R689G Average:7.648; most accessible tissue: Minghui63 flag leaf, score: 12.986 possibly damaging 1.696 TOLERATED 0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111934896 6.92E-06 2.25E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 6.14E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 1.18E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 2.17E-07 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 7.59E-07 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 3.65E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 1.49E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 3.95E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 5.94E-06 3.24E-09 mr1215_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 6.77E-06 4.41E-07 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 8.84E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 9.75E-06 5.04E-07 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111934896 NA 2.05E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251