\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111856161:

Variant ID: vg1111856161 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11856161
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAAGAAGCAACCATCTTAGCATGACGACACGGTGTACAAACCAAATTAAGATCTTTCTTAAGTTTAGGTAAACCACGAACAAGATCCAAACCACTTAA[C/T]
CTAGTGAGATGATCAAAACCAACATGTCCAAGTCTACGATGCCAAAACATCACATCTTTATCAAACTTAGCAACCAAACATGTTATCACAGGTGAAACAG

Reverse complement sequence

CTGTTTCACCTGTGATAACATGTTTGGTTGCTAAGTTTGATAAAGATGTGATGTTTTGGCATCGTAGACTTGGACATGTTGGTTTTGATCATCTCACTAG[G/A]
TTAAGTGGTTTGGATCTTGTTCGTGGTTTACCTAAACTTAAGAAAGATCTTAATTTGGTTTGTACACCGTGTCGTCATGCTAAGATGGTTGCTTCTTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.80% 13.90% 0.19% 0.08% NA
All Indica  2759 78.30% 21.20% 0.33% 0.14% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 98.20% 1.70% 0.17% 0.00% NA
Indica II  465 44.90% 54.00% 1.08% 0.00% NA
Indica III  913 86.00% 13.50% 0.33% 0.22% NA
Indica Intermediate  786 74.20% 25.60% 0.00% 0.25% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111856161 C -> T LOC_Os11g20470.1 intron_variant ; MODIFIER silent_mutation Average:21.501; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 N N N N
vg1111856161 C -> DEL N N silent_mutation Average:21.501; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111856161 NA 7.53E-07 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 8.21E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 3.54E-06 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 2.04E-07 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 8.66E-12 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 4.22E-08 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 6.19E-10 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 2.86E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 1.80E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 1.10E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111856161 NA 3.42E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251