\
| Variant ID: vg1111565611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 11565611 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTTAAATTACTTATCGAAATCATGATCTGATTGCATCATTAAATTCGTTGCAAATAAATCTTCAAAACAAGACCACACATGGATATCCGACAAAAAAA[T/A]
TTTTTAGTTTATTATTGAATTATTTTTAAATGTTGCACGATGTTCCACCAGATATATCGGAATTGTTTCACTAAGTAGATCGAAAATGTTTCACTCGTTT
AAACGAGTGAAACATTTTCGATCTACTTAGTGAAACAATTCCGATATATCTGGTGGAACATCGTGCAACATTTAAAAATAATTCAATAATAAACTAAAAA[A/T]
TTTTTTTGTCGGATATCCATGTGTGGTCTTGTTTTGAAGATTTATTTGCAACGAATTTAATGATGCAATCAGATCATGATTTCGATAAGTAATTTAAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 37.70% | 0.72% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 2.30% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 5.80% | 93.50% | 0.73% | 0.00% | NA |
| Aus | 269 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 1.20% | 2.18% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 3.80% | 95.40% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 10.50% | 89.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 96.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 35.60% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1111565611 | T -> A | LOC_Os11g20070.1 | downstream_gene_variant ; 4534.0bp to feature; MODIFIER | silent_mutation | Average:35.317; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1111565611 | T -> A | LOC_Os11g20060-LOC_Os11g20070 | intergenic_region ; MODIFIER | silent_mutation | Average:35.317; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1111565611 | NA | 1.03E-08 | mr1047 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 1.12E-10 | mr1336 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 3.95E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 1.15E-28 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 6.99E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 1.76E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 6.51E-19 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 6.05E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 2.47E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 1.50E-21 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 3.68E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 1.45E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111565611 | NA | 1.57E-29 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |