\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111511705:

Variant ID: vg1111511705 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11511705
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATATTGTTAATATGTACAGCCGATCGAGTAGATTTAGTTCTTTATTATCTATTTACAACCGCCGATCGATTTAAACATGACATTGGCTCAAAGATAAA[T/C]
GATACGTCATCGGCATCTAGCCGATCGGCTATCATTTATGGATTTAACTACGGTTTCTTTGTCTTTATTTCTTGTTGATTGCATGACCAAATCAACTGGC

Reverse complement sequence

GCCAGTTGATTTGGTCATGCAATCAACAAGAAATAAAGACAAAGAAACCGTAGTTAAATCCATAAATGATAGCCGATCGGCTAGATGCCGATGACGTATC[A/G]
TTTATCTTTGAGCCAATGTCATGTTTAAATCGATCGGCGGTTGTAAATAGATAATAAAGAACTAAATCTACTCGATCGGCTGTACATATTAACAATATAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.30% 0.30% 0.42% 0.00% NA
All Indica  2759 98.90% 0.50% 0.62% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 98.40% 0.50% 1.10% 0.00% NA
Indica Intermediate  786 99.10% 0.60% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111511705 T -> C LOC_Os11g20000.1 upstream_gene_variant ; 2263.0bp to feature; MODIFIER N Average:48.633; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg1111511705 T -> C LOC_Os11g19990.1 downstream_gene_variant ; 4591.0bp to feature; MODIFIER N Average:48.633; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg1111511705 T -> C LOC_Os11g20010.1 downstream_gene_variant ; 984.0bp to feature; MODIFIER N Average:48.633; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N
vg1111511705 T -> C LOC_Os11g20000-LOC_Os11g20010 intergenic_region ; MODIFIER N Average:48.633; most accessible tissue: Zhenshan97 flag leaf, score: 74.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111511705 2.67E-06 8.15E-06 mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111511705 4.35E-06 5.48E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111511705 1.88E-06 NA mr1261 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251