\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111465097:

Variant ID: vg1111465097 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11465097
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGCAATGGTTTCCAATCAAATAGTGTCTCCAAATCTTTAGCTCATGAACCACGACTGCTAGTTCTAGGTCATGGGTAGGGTAATTTTCCTCGTGTGGTC[G/A]
CAGTTGTCGCGATGCATAAGCCACGTCCTTTCCTTCTTGCATCAGTACTCCTCCCCAGTCCTTGCCTTGATGCATCACAATATATAACAAAGTCTTTCCT

Reverse complement sequence

AGGAAAGACTTTGTTATATATTGTGATGCATCAAGGCAAGGACTGGGGAGGAGTACTGATGCAAGAAGGAAAGGACGTGGCTTATGCATCGCGACAACTG[C/T]
GACCACACGAGGAAAATTACCCTACCCATGACCTAGAACTAGCAGTCGTGGTTCATGAGCTAAAGATTTGGAGACACTATTTGATTGGAAACCATTGCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 1.60% 28.80% 26.30% NA
All Indica  2759 12.00% 2.70% 47.92% 37.37% NA
All Japonica  1512 95.40% 0.00% 0.53% 4.10% NA
Aus  269 53.90% 0.00% 5.58% 40.52% NA
Indica I  595 10.90% 2.00% 61.85% 25.21% NA
Indica II  465 15.90% 1.10% 23.66% 59.35% NA
Indica III  913 10.00% 4.40% 50.93% 34.72% NA
Indica Intermediate  786 13.00% 2.20% 48.22% 36.64% NA
Temperate Japonica  767 96.60% 0.00% 0.52% 2.87% NA
Tropical Japonica  504 92.50% 0.00% 0.00% 7.54% NA
Japonica Intermediate  241 97.50% 0.00% 1.66% 0.83% NA
VI/Aromatic  96 85.40% 0.00% 3.12% 11.46% NA
Intermediate  90 51.10% 1.10% 14.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111465097 G -> A LOC_Os11g19910.1 stop_gained ; p.Arg834*; HIGH stop_gained Average:11.162; most accessible tissue: Callus, score: 20.378 N N N N
vg1111465097 G -> DEL LOC_Os11g19910.1 N frameshift_variant Average:11.162; most accessible tissue: Callus, score: 20.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111465097 NA 1.20E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 3.81E-07 4.09E-07 mr1011 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 2.43E-06 3.15E-06 mr1012 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 1.33E-21 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 4.80E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 1.69E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 2.59E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 2.53E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 2.26E-90 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 3.50E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 3.54E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 3.54E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 2.63E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 2.13E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111465097 NA 4.93E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251