\
| Variant ID: vg1111465097 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 11465097 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCGCAATGGTTTCCAATCAAATAGTGTCTCCAAATCTTTAGCTCATGAACCACGACTGCTAGTTCTAGGTCATGGGTAGGGTAATTTTCCTCGTGTGGTC[G/A]
CAGTTGTCGCGATGCATAAGCCACGTCCTTTCCTTCTTGCATCAGTACTCCTCCCCAGTCCTTGCCTTGATGCATCACAATATATAACAAAGTCTTTCCT
AGGAAAGACTTTGTTATATATTGTGATGCATCAAGGCAAGGACTGGGGAGGAGTACTGATGCAAGAAGGAAAGGACGTGGCTTATGCATCGCGACAACTG[C/T]
GACCACACGAGGAAAATTACCCTACCCATGACCTAGAACTAGCAGTCGTGGTTCATGAGCTAAAGATTTGGAGACACTATTTGATTGGAAACCATTGCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.30% | 1.60% | 28.80% | 26.30% | NA |
| All Indica | 2759 | 12.00% | 2.70% | 47.92% | 37.37% | NA |
| All Japonica | 1512 | 95.40% | 0.00% | 0.53% | 4.10% | NA |
| Aus | 269 | 53.90% | 0.00% | 5.58% | 40.52% | NA |
| Indica I | 595 | 10.90% | 2.00% | 61.85% | 25.21% | NA |
| Indica II | 465 | 15.90% | 1.10% | 23.66% | 59.35% | NA |
| Indica III | 913 | 10.00% | 4.40% | 50.93% | 34.72% | NA |
| Indica Intermediate | 786 | 13.00% | 2.20% | 48.22% | 36.64% | NA |
| Temperate Japonica | 767 | 96.60% | 0.00% | 0.52% | 2.87% | NA |
| Tropical Japonica | 504 | 92.50% | 0.00% | 0.00% | 7.54% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 3.12% | 11.46% | NA |
| Intermediate | 90 | 51.10% | 1.10% | 14.44% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1111465097 | G -> A | LOC_Os11g19910.1 | stop_gained ; p.Arg834*; HIGH | stop_gained | Average:11.162; most accessible tissue: Callus, score: 20.378 | N | N | N | N |
| vg1111465097 | G -> DEL | LOC_Os11g19910.1 | N | frameshift_variant | Average:11.162; most accessible tissue: Callus, score: 20.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1111465097 | NA | 1.20E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | 3.81E-07 | 4.09E-07 | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | 2.43E-06 | 3.15E-06 | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 1.33E-21 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 4.80E-07 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 1.69E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 2.59E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 2.53E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 2.26E-90 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 3.50E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 3.54E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 3.54E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 2.63E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 2.13E-21 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111465097 | NA | 4.93E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |