Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111385027:

Variant ID: vg1111385027 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 11385027
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AAGACACATGGTGAATGGGGAGAACTCAAAAGCATGTTTTGTCTTGCTTTCTTCCTGTTAACCCGTGATGTCTTCCTATGGATGGAAATTCTCGGCTTTT[A/G]
GCAGAGTGAGAAGAAGTCTGCCTCGTATGTTGATTTTTTCACCGGAGGCTAGTCGCACTGCAGAAGGTAGGGATTGTATCGTAGAGAACACCTCCCATCG

Reverse complement sequence

CGATGGGAGGTGTTCTCTACGATACAATCCCTACCTTCTGCAGTGCGACTAGCCTCCGGTGAAAAAATCAACATACGAGGCAGACTTCTTCTCACTCTGC[T/C]
AAAAGCCGAGAATTTCCATCCATAGGAAGACATCACGGGTTAACAGGAAGAAAGCAAGACAAAACATGCTTTTGAGTTCTCCCCATTCACCATGTGTCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	5.40%	1.46%	0.00%	NA
All Indica	2759	88.70%	9.00%	2.32%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.80%	0.20%	5.04%	0.00%	NA
Indica II	465	81.10%	15.30%	3.66%	0.00%	NA
Indica III	913	89.70%	10.00%	0.33%	0.00%	NA
Indica Intermediate	786	87.30%	10.90%	1.78%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	6.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1111385027	A -> G	LOC_Os11g19760.1	downstream_gene_variant ; 1178.0bp to feature; MODIFIER	silent_mutation	Average:58.62; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1111385027	A -> G	LOC_Os11g19764.1	downstream_gene_variant ; 1167.0bp to feature; MODIFIER	silent_mutation	Average:58.62; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1111385027	A -> G	LOC_Os11g19764.2	downstream_gene_variant ; 3257.0bp to feature; MODIFIER	silent_mutation	Average:58.62; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1111385027	A -> G	LOC_Os11g19764.3	downstream_gene_variant ; 3257.0bp to feature; MODIFIER	silent_mutation	Average:58.62; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N
vg1111385027	A -> G	LOC_Os11g19760-LOC_Os11g19764	intergenic_region ; MODIFIER	silent_mutation	Average:58.62; most accessible tissue: Zhenshan97 young leaf, score: 78.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1111385027	9.20E-06	NA	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111385027	8.73E-06	NA	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111385027	9.39E-06	NA	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111385027	1.98E-06	NA	mr1120_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111385027	5.77E-07	NA	mr1247_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251