\
| Variant ID: vg1111156033 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 11156033 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.00, others allele: 0.00, population size: 295. )
GGCTCATGTCACAAGACAAAAAGTGGGTTCAAGAACTCCCATCAGTACTATGGGCCGTACGCACCACACCGACAACGTCCAATAAGGAAACACCATTCTT[C/A]
CTCGTGTACGGCTCCGAGGCCATGCTCCCCGGCGAGCTACGACATCAGAGTACACGAGTACAGAAGTATTCCGACGAGAACCAGGAGGAACAGTGAGACA
TGTCTCACTGTTCCTCCTGGTTCTCGTCGGAATACTTCTGTACTCGTGTACTCTGATGTCGTAGCTCGCCGGGGAGCATGGCCTCGGAGCCGTACACGAG[G/T]
AAGAATGGTGTTTCCTTATTGGACGTTGTCGGTGTGGTGCGTACGGCCCATAGTACTGATGGGAGTTCTTGAACCCACTTTTTGTCTTGTGACATGAGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 13.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 78.70% | 21.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 45.60% | 54.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 86.40% | 13.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1111156033 | C -> A | LOC_Os11g19390.1 | missense_variant ; p.Phe394Leu; MODERATE | nonsynonymous_codon ; F394L | Average:50.67; most accessible tissue: Minghui63 young leaf, score: 70.655 | possibly damaging |
1.576 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1111156033 | NA | 9.28E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 2.75E-07 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.47E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 3.91E-07 | mr1609 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.61E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.96E-13 | mr1829 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.70E-09 | mr1842 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.81E-10 | mr1902 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 9.25E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.68E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 7.91E-11 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 1.29E-10 | mr1829_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 5.99E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 5.03E-10 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111156033 | NA | 4.58E-07 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |