\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111107806:

Variant ID: vg1111107806 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11107806
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGGGAACCAAGCATAGCCTTATTATGGGATGGATACAGCAATTGTGTTGTTTGCATGGTTCATAGAAAGTATTAAATCAGGTGGAAATGGGCACGCAT[G/A]
TAGCTGGAACTATGATAAGGCACTAGAATAGTATTTAATTACAAGAAGAAAATAGTGATTTTTATTTAAAAAGCATCATGTTTTTTGTTATAAGAAATAA

Reverse complement sequence

TTATTTCTTATAACAAAAAACATGATGCTTTTTAAATAAAAATCACTATTTTCTTCTTGTAATTAAATACTATTCTAGTGCCTTATCATAGTTCCAGCTA[C/T]
ATGCGTGCCCATTTCCACCTGATTTAATACTTTCTATGAACCATGCAAACAACACAATTGCTGTATCCATCCCATAATAAGGCTATGCTTGGTTCCCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 48.90% 0.06% 0.00% NA
All Indica  2759 27.30% 72.60% 0.11% 0.00% NA
All Japonica  1512 96.60% 3.40% 0.00% 0.00% NA
Aus  269 18.20% 81.80% 0.00% 0.00% NA
Indica I  595 7.70% 92.30% 0.00% 0.00% NA
Indica II  465 60.00% 39.80% 0.22% 0.00% NA
Indica III  913 14.10% 85.90% 0.00% 0.00% NA
Indica Intermediate  786 38.00% 61.70% 0.25% 0.00% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111107806 G -> A LOC_Os11g19340.1 downstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:30.624; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N
vg1111107806 G -> A LOC_Os11g19330-LOC_Os11g19340 intergenic_region ; MODIFIER silent_mutation Average:30.624; most accessible tissue: Zhenshan97 young leaf, score: 57.159 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111107806 NA 2.04E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 8.51E-06 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 9.73E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 3.67E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 3.30E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 1.84E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 7.31E-06 mr1758 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 9.86E-10 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 1.43E-10 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 1.11E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 5.93E-08 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 2.81E-16 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 4.71E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 2.91E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 8.77E-08 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 1.79E-09 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 3.04E-06 8.89E-07 mr1223_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 4.19E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806 NA 2.97E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251