Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111107806:

Variant ID: vg1111107806 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 11107806
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGGGAACCAAGCATAGCCTTATTATGGGATGGATACAGCAATTGTGTTGTTTGCATGGTTCATAGAAAGTATTAAATCAGGTGGAAATGGGCACGCAT[G/A]
TAGCTGGAACTATGATAAGGCACTAGAATAGTATTTAATTACAAGAAGAAAATAGTGATTTTTATTTAAAAAGCATCATGTTTTTTGTTATAAGAAATAA

Reverse complement sequence

TTATTTCTTATAACAAAAAACATGATGCTTTTTAAATAAAAATCACTATTTTCTTCTTGTAATTAAATACTATTCTAGTGCCTTATCATAGTTCCAGCTA[C/T]
ATGCGTGCCCATTTCCACCTGATTTAATACTTTCTATGAACCATGCAAACAACACAATTGCTGTATCCATCCCATAATAAGGCTATGCTTGGTTCCCTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	48.90%	0.06%	0.00%	NA
All Indica	2759	27.30%	72.60%	0.11%	0.00%	NA
All Japonica	1512	96.60%	3.40%	0.00%	0.00%	NA
Aus	269	18.20%	81.80%	0.00%	0.00%	NA
Indica I	595	7.70%	92.30%	0.00%	0.00%	NA
Indica II	465	60.00%	39.80%	0.22%	0.00%	NA
Indica III	913	14.10%	85.90%	0.00%	0.00%	NA
Indica Intermediate	786	38.00%	61.70%	0.25%	0.00%	NA
Temperate Japonica	767	98.60%	1.40%	0.00%	0.00%	NA
Tropical Japonica	504	92.90%	7.10%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1111107806	G -> A	LOC_Os11g19340.1	downstream_gene_variant ; 2720.0bp to feature; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N
vg1111107806	G -> A	LOC_Os11g19330-LOC_Os11g19340	intergenic_region ; MODIFIER	silent_mutation	Average:30.624; most accessible tissue: Zhenshan97 young leaf, score: 57.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1111107806	NA	2.04E-11	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	8.51E-06	mr1154	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	9.73E-11	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	3.67E-15	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	3.30E-07	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	1.84E-13	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	7.31E-06	mr1758	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	9.86E-10	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	1.43E-10	mr1829	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	1.11E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	5.93E-08	mr1842	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	2.81E-16	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	4.71E-09	mr1902	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	2.91E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	8.77E-08	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	1.79E-09	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	3.04E-06	8.89E-07	mr1223_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	4.19E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111107806	NA	2.97E-16	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251