\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111074881:

Variant ID: vg1111074881 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11074881
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


AGAATAAGTTTCATTATGTTGTATCGTATTCTTCATCTAACGTGTCCTAACTGTACCCCATGTCGAACTGAATGCTGAGAGACAGGCCTCCCAAGAGGTC[T/C]
GCTCACAAAGACAGGAGGATGACATCCTCACGAAAGTGTTGGGAAACGAAGAACACCATGGATGAACAAGGGGCATTGGCTCCAATGTTCCATGGAAGTT

Reverse complement sequence

AACTTCCATGGAACATTGGAGCCAATGCCCCTTGTTCATCCATGGTGTTCTTCGTTTCCCAACACTTTCGTGAGGATGTCATCCTCCTGTCTTTGTGAGC[A/G]
GACCTCTTGGGAGGCCTGTCTCTCAGCATTCAGTTCGACATGGGGTACAGTTAGGACACGTTAGATGAAGAATACGATACAACATAATGAAACTTATTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 42.50% 0.59% 0.68% NA
All Indica  2759 35.00% 64.60% 0.36% 0.00% NA
All Japonica  1512 96.60% 3.40% 0.07% 0.00% NA
Aus  269 30.10% 51.70% 6.32% 11.90% NA
Indica I  595 9.10% 90.30% 0.67% 0.00% NA
Indica II  465 61.50% 38.30% 0.22% 0.00% NA
Indica III  913 30.90% 68.90% 0.22% 0.00% NA
Indica Intermediate  786 43.90% 55.70% 0.38% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 92.70% 7.10% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111074881 T -> DEL N N silent_mutation Average:49.497; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1111074881 T -> C LOC_Os11g19320.1 upstream_gene_variant ; 2940.0bp to feature; MODIFIER silent_mutation Average:49.497; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1111074881 T -> C LOC_Os11g19310.1 downstream_gene_variant ; 3880.0bp to feature; MODIFIER silent_mutation Average:49.497; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1111074881 T -> C LOC_Os11g19330.1 intron_variant ; MODIFIER silent_mutation Average:49.497; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111074881 NA 2.88E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 5.65E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 5.93E-06 mr1154 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 6.63E-11 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 6.32E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 8.90E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 2.31E-07 NA mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 1.77E-07 6.71E-09 mr1758 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 2.43E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 6.28E-11 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 6.42E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 8.49E-15 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 6.59E-09 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 7.99E-07 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 6.82E-09 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 9.70E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 1.76E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 3.50E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111074881 NA 8.34E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251