Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111043318:

Variant ID: vg1111043318 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 11043318
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAACCTACAATGACGAGAAGCTATCTTACTTAAATAAGAAAAGTAAACACCATAAGGAAATCTCGAATACTTACTTTGTTGAAGAAAGCATTCGCCGA[G/T]
GTACACAAAATGAAGTCAACCACTAACCTATACACCACGCCTAAGTGATTCTAGCCTCACGCAAGAACTTCCTTCTTTATCTAGAATATTAGTACTAGAG

Reverse complement sequence

CTCTAGTACTAATATTCTAGATAAAGAAGGAAGTTCTTGCGTGAGGCTAGAATCACTTAGGCGTGGTGTATAGGTTAGTGGTTGACTTCATTTTGTGTAC[C/A]
TCGGCGAATGCTTTCTTCAACAAAGTAAGTATTCGAGATTTCCTTATGGTGTTTACTTTTCTTATTTAAGTAAGATAGCTTCTCGTCATTGTAGGTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.70%	1.50%	0.85%	0.00%	NA
All Indica	2759	96.10%	2.50%	1.41%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.10%	0.00%	2.86%	0.00%	NA
Indica II	465	89.00%	8.60%	2.37%	0.00%	NA
Indica III	913	99.30%	0.40%	0.22%	0.00%	NA
Indica Intermediate	786	95.70%	3.20%	1.15%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1111043318	G -> T	LOC_Os11g19280.1	upstream_gene_variant ; 4654.0bp to feature; MODIFIER	silent_mutation	Average:41.709; most accessible tissue: Callus, score: 68.229	N	N	N	N
vg1111043318	G -> T	LOC_Os11g19270.1	downstream_gene_variant ; 3206.0bp to feature; MODIFIER	silent_mutation	Average:41.709; most accessible tissue: Callus, score: 68.229	N	N	N	N
vg1111043318	G -> T	LOC_Os11g19260-LOC_Os11g19270	intergenic_region ; MODIFIER	silent_mutation	Average:41.709; most accessible tissue: Callus, score: 68.229	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1111043318	6.23E-06	6.22E-06	mr1054	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	1.63E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	2.57E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	3.95E-06	mr1122	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	5.99E-07	5.99E-07	mr1287	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	1.77E-06	mr1297	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	2.65E-06	7.07E-08	mr1372	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	2.85E-06	2.99E-08	mr1432	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	1.38E-06	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	3.11E-06	3.11E-06	mr1465	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	6.48E-07	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	7.95E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	2.32E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	1.47E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	1.13E-07	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	5.17E-07	mr1956	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	8.69E-08	mr1958	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	1.94E-06	1.94E-06	mr1972	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	4.71E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111043318	NA	4.71E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251