Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1111023509:

Variant ID: vg1111023509 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 11023509
Reference Allele: A	Alternative Allele: T,ACT
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, A: 0.24, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGTATATTTAACAATAAATCAAATGGTAGGAAAAAAATTAATAATTACTTAAACTTTTTTAATAAGACGAATGGTCAAATATTTTTTAAAAATTAAC[A/T,ACT]
GCGTTAAATATTTTGGAGGGAGTACATAGAAACATTTTGGAGGGAGTACATAGAATTTTATTGTAGTAGATTTAATAAGTCAGACCTAGCACGATAGTTA

Reverse complement sequence

TAACTATCGTGCTAGGTCTGACTTATTAAATCTACTACAATAAAATTCTATGTACTCCCTCCAAAATGTTTCTATGTACTCCCTCCAAAATATTTAACGC[T/A,AGT]
GTTAATTTTTAAAAAATATTTGACCATTCGTCTTATTAAAAAAGTTTAAGTAATTATTAATTTTTTTCCTACCATTTGATTTATTGTTAAATATACTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.40%	36.90%	0.19%	1.31%	ACT: 0.11%
All Indica	2759	92.10%	6.20%	0.29%	1.27%	ACT: 0.18%
All Japonica	1512	4.00%	95.90%	0.07%	0.00%	NA
Aus	269	88.80%	1.10%	0.00%	10.04%	NA
Indica I	595	91.90%	6.90%	0.34%	0.84%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	95.90%	0.90%	0.11%	2.52%	ACT: 0.55%
Indica Intermediate	786	85.90%	12.70%	0.51%	0.89%	NA
Temperate Japonica	767	1.80%	98.00%	0.13%	0.00%	NA
Tropical Japonica	504	8.10%	91.90%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1111023509	A -> T	LOC_Os11g19260.1	upstream_gene_variant ; 1302.0bp to feature; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N
vg1111023509	A -> T	LOC_Os11g19250.1	downstream_gene_variant ; 211.0bp to feature; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N
vg1111023509	A -> T	LOC_Os11g19250-LOC_Os11g19260	intergenic_region ; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N
vg1111023509	A -> ACT	LOC_Os11g19260.1	upstream_gene_variant ; 1301.0bp to feature; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N
vg1111023509	A -> ACT	LOC_Os11g19250.1	downstream_gene_variant ; 212.0bp to feature; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N
vg1111023509	A -> ACT	LOC_Os11g19250-LOC_Os11g19260	intergenic_region ; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N
vg1111023509	A -> DEL	N	N	silent_mutation	Average:56.913; most accessible tissue: Callus, score: 78.989	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1111023509	NA	1.41E-22	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111023509	NA	4.94E-10	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111023509	NA	1.06E-31	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111023509	3.17E-07	1.22E-93	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111023509	2.76E-06	9.48E-07	mr1758	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251