Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111006518:

Variant ID: vg1111006518 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 11006518
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTTTGCATACCATATAAACTTCTACTGGTCACACTATAGAAGATATGCACTTGCTGTTGATTATGTAAATGTTATATACTGAAGTACTATTTTGAGCA[C/A]
TTGCTATTGATCATGTAAATGTTATATACTGAAGTACTATTTTGAGACATTTTTTATAGAGTAAAGTGCACGGGCGGTCCTTAAACTTGTAGGGGTATGT

Reverse complement sequence

ACATACCCCTACAAGTTTAAGGACCGCCCGTGCACTTTACTCTATAAAAAATGTCTCAAAATAGTACTTCAGTATATAACATTTACATGATCAATAGCAA[G/T]
TGCTCAAAATAGTACTTCAGTATATAACATTTACATAATCAACAGCAAGTGCATATCTTCTATAGTGTGACCAGTAGAAGTTTATATGGTATGCAAACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	1.20%	1.46%	10.90%	NA
All Indica	2759	80.40%	0.00%	1.45%	18.12%	NA
All Japonica	1512	93.90%	3.80%	1.72%	0.60%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	71.60%	0.00%	2.02%	26.39%	NA
Indica II	465	99.10%	0.00%	0.00%	0.86%	NA
Indica III	913	71.00%	0.00%	1.97%	27.05%	NA
Indica Intermediate	786	87.00%	0.00%	1.27%	11.70%	NA
Temperate Japonica	767	99.00%	0.10%	0.26%	0.65%	NA
Tropical Japonica	504	84.30%	10.90%	4.37%	0.40%	NA
Japonica Intermediate	241	97.90%	0.40%	0.83%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	0.00%	3.33%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1111006518	C -> A	LOC_Os11g19240-LOC_Os11g19250	intergenic_region ; MODIFIER	silent_mutation	Average:45.875; most accessible tissue: Minghui63 root, score: 62.438	N	N	N	N
vg1111006518	C -> DEL	N	N	silent_mutation	Average:45.875; most accessible tissue: Minghui63 root, score: 62.438	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1111006518	NA	3.23E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	7.29E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	2.58E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	1.88E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	2.31E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	9.23E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	5.57E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	3.09E-06	3.08E-06	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111006518	NA	5.57E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251