\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110835875:

Variant ID: vg1110835875 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10835875
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGCCTGCGATAATGGCACTATAAAGTCATCTTCCTCCCCGAGCCCTATTCATTCTATTTGGTGTTTCTCTCTCTTAAAGGGACTTAAATACAGGGGGAG[G/T]
TTTTGAACTTCAAATCTTCGAGGGATTTTTCTACGGTGGTTAGATCTACTCCTTTCCACCCTAGGTATGCATTTTTTTAGGCTTTTAGACCTTAATTTGT

Reverse complement sequence

ACAAATTAAGGTCTAAAAGCCTAAAAAAATGCATACCTAGGGTGGAAAGGAGTAGATCTAACCACCGTAGAAAAATCCCTCGAAGATTTGAAGTTCAAAA[C/A]
CTCCCCCTGTATTTAAGTCCCTTTAAGAGAGAGAAACACCAAATAGAATGAATAGGGCTCGGGGAGGAAGATGACTTTATAGTGCCATTATCGCAGGCGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 7.40% 1.97% 0.00% NA
All Indica  2759 99.30% 0.10% 0.54% 0.00% NA
All Japonica  1512 72.40% 22.60% 5.03% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 98.20% 0.40% 1.40% 0.00% NA
Temperate Japonica  767 92.30% 3.00% 4.69% 0.00% NA
Tropical Japonica  504 49.20% 46.00% 4.76% 0.00% NA
Japonica Intermediate  241 57.30% 36.10% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110835875 G -> T LOC_Os11g19000.1 upstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1110835875 G -> T LOC_Os11g19010.1 upstream_gene_variant ; 2865.0bp to feature; MODIFIER silent_mutation Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1110835875 G -> T LOC_Os11g19020.1 upstream_gene_variant ; 4165.0bp to feature; MODIFIER silent_mutation Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1110835875 G -> T LOC_Os11g18990.1 downstream_gene_variant ; 3942.0bp to feature; MODIFIER silent_mutation Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg1110835875 G -> T LOC_Os11g18990-LOC_Os11g19000 intergenic_region ; MODIFIER silent_mutation Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110835875 NA 1.17E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 6.78E-09 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 4.76E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 NA 9.62E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 4.15E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 5.03E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 2.33E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 NA 9.19E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 1.35E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 NA 2.11E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 NA 2.03E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110835875 NA 4.43E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251