\
| Variant ID: vg1110835875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10835875 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGCCTGCGATAATGGCACTATAAAGTCATCTTCCTCCCCGAGCCCTATTCATTCTATTTGGTGTTTCTCTCTCTTAAAGGGACTTAAATACAGGGGGAG[G/T]
TTTTGAACTTCAAATCTTCGAGGGATTTTTCTACGGTGGTTAGATCTACTCCTTTCCACCCTAGGTATGCATTTTTTTAGGCTTTTAGACCTTAATTTGT
ACAAATTAAGGTCTAAAAGCCTAAAAAAATGCATACCTAGGGTGGAAAGGAGTAGATCTAACCACCGTAGAAAAATCCCTCGAAGATTTGAAGTTCAAAA[C/A]
CTCCCCCTGTATTTAAGTCCCTTTAAGAGAGAGAAACACCAAATAGAATGAATAGGGCTCGGGGAGGAAGATGACTTTATAGTGCCATTATCGCAGGCGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 7.40% | 1.97% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.10% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 72.40% | 22.60% | 5.03% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 0.40% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 92.30% | 3.00% | 4.69% | 0.00% | NA |
| Tropical Japonica | 504 | 49.20% | 46.00% | 4.76% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 36.10% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110835875 | G -> T | LOC_Os11g19000.1 | upstream_gene_variant ; 749.0bp to feature; MODIFIER | silent_mutation | Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1110835875 | G -> T | LOC_Os11g19010.1 | upstream_gene_variant ; 2865.0bp to feature; MODIFIER | silent_mutation | Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1110835875 | G -> T | LOC_Os11g19020.1 | upstream_gene_variant ; 4165.0bp to feature; MODIFIER | silent_mutation | Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1110835875 | G -> T | LOC_Os11g18990.1 | downstream_gene_variant ; 3942.0bp to feature; MODIFIER | silent_mutation | Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg1110835875 | G -> T | LOC_Os11g18990-LOC_Os11g19000 | intergenic_region ; MODIFIER | silent_mutation | Average:42.971; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110835875 | NA | 1.17E-06 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | 6.78E-09 | NA | mr1082_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | 4.76E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | NA | 9.62E-06 | mr1088_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | 4.15E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | 5.03E-07 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | 2.33E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | NA | 9.19E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | 1.35E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | NA | 2.11E-06 | mr1246_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | NA | 2.03E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110835875 | NA | 4.43E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |