\
| Variant ID: vg1110833634 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10833634 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )
AATATGAATTAATTTTTACTACTCCCTCCATCCAAAAGTCTTAGAGAAGGTACATTAGGAGACTATAGGTCAGCTATAAACACATGTCGAGAAGATAAAA[G/C,A]
AGGAGAGAAGAGGAACGTGATACAGATTTGTAACCAGCTGCAACACGGACTACTCTAAAACACAATGTGTATATGATAGGTGGGACCATATATTAATAAT
ATTATTAATATATGGTCCCACCTATCATATACACATTGTGTTTTAGAGTAGTCCGTGTTGCAGCTGGTTACAAATCTGTATCACGTTCCTCTTCTCTCCT[C/G,T]
TTTTATCTTCTCGACATGTGTTTATAGCTGACCTATAGTCTCCTAATGTACCTTCTCTAAGACTTTTGGATGGAGGGAGTAGTAAAAATTAATTCATATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 6.60% | 3.45% | 0.00% | A: 0.70% |
| All Indica | 2759 | 83.10% | 11.00% | 5.69% | 0.00% | A: 0.14% |
| All Japonica | 1512 | 97.90% | 0.10% | 0.20% | 0.00% | A: 1.85% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.20% | 0.80% | 13.95% | 0.00% | NA |
| Indica II | 465 | 70.80% | 21.10% | 8.17% | 0.00% | NA |
| Indica III | 913 | 88.30% | 11.10% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 12.70% | 3.82% | 0.00% | A: 0.51% |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.00% | 0.00% | 0.40% | 0.00% | A: 5.56% |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 3.33% | 0.00% | A: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110833634 | G -> A | LOC_Os11g19000.1 | upstream_gene_variant ; 2990.0bp to feature; MODIFIER | silent_mutation | Average:48.629; most accessible tissue: Callus, score: 64.798 | N | N | N | N |
| vg1110833634 | G -> A | LOC_Os11g18990.1 | downstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:48.629; most accessible tissue: Callus, score: 64.798 | N | N | N | N |
| vg1110833634 | G -> A | LOC_Os11g18990-LOC_Os11g19000 | intergenic_region ; MODIFIER | silent_mutation | Average:48.629; most accessible tissue: Callus, score: 64.798 | N | N | N | N |
| vg1110833634 | G -> C | LOC_Os11g19000.1 | upstream_gene_variant ; 2990.0bp to feature; MODIFIER | silent_mutation | Average:48.629; most accessible tissue: Callus, score: 64.798 | N | N | N | N |
| vg1110833634 | G -> C | LOC_Os11g18990.1 | downstream_gene_variant ; 1701.0bp to feature; MODIFIER | silent_mutation | Average:48.629; most accessible tissue: Callus, score: 64.798 | N | N | N | N |
| vg1110833634 | G -> C | LOC_Os11g18990-LOC_Os11g19000 | intergenic_region ; MODIFIER | silent_mutation | Average:48.629; most accessible tissue: Callus, score: 64.798 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110833634 | NA | 1.10E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110833634 | 4.49E-06 | 4.49E-06 | mr1872 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110833634 | NA | 9.83E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110833634 | NA | 2.51E-06 | mr1958 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |