\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110833634:

Variant ID: vg1110833634 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10833634
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


AATATGAATTAATTTTTACTACTCCCTCCATCCAAAAGTCTTAGAGAAGGTACATTAGGAGACTATAGGTCAGCTATAAACACATGTCGAGAAGATAAAA[G/C,A]
AGGAGAGAAGAGGAACGTGATACAGATTTGTAACCAGCTGCAACACGGACTACTCTAAAACACAATGTGTATATGATAGGTGGGACCATATATTAATAAT

Reverse complement sequence

ATTATTAATATATGGTCCCACCTATCATATACACATTGTGTTTTAGAGTAGTCCGTGTTGCAGCTGGTTACAAATCTGTATCACGTTCCTCTTCTCTCCT[C/G,T]
TTTTATCTTCTCGACATGTGTTTATAGCTGACCTATAGTCTCCTAATGTACCTTCTCTAAGACTTTTGGATGGAGGGAGTAGTAAAAATTAATTCATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 6.60% 3.45% 0.00% A: 0.70%
All Indica  2759 83.10% 11.00% 5.69% 0.00% A: 0.14%
All Japonica  1512 97.90% 0.10% 0.20% 0.00% A: 1.85%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.20% 0.80% 13.95% 0.00% NA
Indica II  465 70.80% 21.10% 8.17% 0.00% NA
Indica III  913 88.30% 11.10% 0.66% 0.00% NA
Indica Intermediate  786 83.00% 12.70% 3.82% 0.00% A: 0.51%
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 0.00% 0.40% 0.00% A: 5.56%
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 5.60% 3.33% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110833634 G -> A LOC_Os11g19000.1 upstream_gene_variant ; 2990.0bp to feature; MODIFIER silent_mutation Average:48.629; most accessible tissue: Callus, score: 64.798 N N N N
vg1110833634 G -> A LOC_Os11g18990.1 downstream_gene_variant ; 1701.0bp to feature; MODIFIER silent_mutation Average:48.629; most accessible tissue: Callus, score: 64.798 N N N N
vg1110833634 G -> A LOC_Os11g18990-LOC_Os11g19000 intergenic_region ; MODIFIER silent_mutation Average:48.629; most accessible tissue: Callus, score: 64.798 N N N N
vg1110833634 G -> C LOC_Os11g19000.1 upstream_gene_variant ; 2990.0bp to feature; MODIFIER silent_mutation Average:48.629; most accessible tissue: Callus, score: 64.798 N N N N
vg1110833634 G -> C LOC_Os11g18990.1 downstream_gene_variant ; 1701.0bp to feature; MODIFIER silent_mutation Average:48.629; most accessible tissue: Callus, score: 64.798 N N N N
vg1110833634 G -> C LOC_Os11g18990-LOC_Os11g19000 intergenic_region ; MODIFIER silent_mutation Average:48.629; most accessible tissue: Callus, score: 64.798 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110833634 NA 1.10E-06 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110833634 4.49E-06 4.49E-06 mr1872 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110833634 NA 9.83E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110833634 NA 2.51E-06 mr1958 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251