\
| Variant ID: vg1110664454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10664454 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 263. )
CGATCCACTTGGTGAATTTATCGATCGCCACGAATAGAAATTTGTAGCCGCCCTGTCCTCGTGGGAATGGTCCGAGTATATCGAGCCCCCAGCACGAGAA[C/T]
GACCAAGTAAGAGGGATAGTCTGGAGCACTTGCGCTGGCAGTTTTGTGTGTTTGCTGTGAAATTGATAGGCTTCACACCGCTGCACCATGTCGCAGGCGT
ACGCCTGCGACATGGTGCAGCGGTGTGAAGCCTATCAATTTCACAGCAAACACACAAAACTGCCAGCGCAAGTGCTCCAGACTATCCCTCTTACTTGGTC[G/A]
TTCTCGTGCTGGGGGCTCGATATACTCGGACCATTCCCACGAGGACAGGGCGGCTACAAATTTCTATTCGTGGCGATCGATAAATTCACCAAGTGGATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 5.30% | 0.61% | 3.53% | NA |
| All Indica | 2759 | 93.20% | 1.20% | 0.87% | 4.75% | NA |
| All Japonica | 1512 | 97.50% | 0.70% | 0.00% | 1.79% | NA |
| Aus | 269 | 46.80% | 50.90% | 1.49% | 0.74% | NA |
| Indica I | 595 | 87.40% | 0.00% | 3.53% | 9.08% | NA |
| Indica II | 465 | 96.30% | 0.20% | 0.22% | 3.23% | NA |
| Indica III | 913 | 98.40% | 1.30% | 0.11% | 0.22% | NA |
| Indica Intermediate | 786 | 89.80% | 2.40% | 0.13% | 7.63% | NA |
| Temperate Japonica | 767 | 97.90% | 0.30% | 0.00% | 1.83% | NA |
| Tropical Japonica | 504 | 97.20% | 0.20% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 68.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 86.70% | 6.70% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110664454 | C -> T | LOC_Os11g18790.1 | synonymous_variant ; p.Ser767Ser; LOW | synonymous_codon | Average:56.654; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg1110664454 | C -> T | LOC_Os11g18790.1 | synonymous_variant ; p.Ser767Ser; LOW | nonsynonymous_codon ; S767P | Average:56.654; most accessible tissue: Minghui63 flag leaf, score: 72.472 | benign |
-0.582 |
TOLERATED | 1.00 |
| vg1110664454 | C -> T | LOC_Os11g18790.1 | synonymous_variant ; p.Ser767Ser; LOW | nonsynonymous_codon ; S767L | Average:56.654; most accessible tissue: Minghui63 flag leaf, score: 72.472 | benign |
-0.036 |
DELETERIOUS | 0.05 |
| vg1110664454 | C -> DEL | LOC_Os11g18790.1 | N | frameshift_variant | Average:56.654; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110664454 | NA | 4.00E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 4.70E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 1.58E-17 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 1.20E-18 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 5.81E-18 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 4.04E-23 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 1.96E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | 1.30E-11 | 2.21E-45 | mr1550 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 3.95E-18 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 1.05E-17 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 3.24E-18 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 2.06E-17 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 1.48E-21 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | NA | 9.21E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110664454 | 2.13E-11 | 2.03E-48 | mr1550_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |