Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110517362:

Variant ID: vg1110517362 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10517362
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AGGTGATTGAGGAGTCAATCACAAGTTATATAATCTATCACAGGTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCTTGAGCTTAAT[T/C]
GATATCGTGGCAAAAGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGACCGGTGGGTCAATACATTCTGCTAGGGGCCGC

Reverse complement sequence

GCGGCCCCTAGCAGAATGTATTGACCCACCGGTCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAACCCTTTTGCCACGATATC[A/G]
ATTAAGCTCAAGGCTAGATATGTGCCATCCTCTAATAGCTCAATCATTCACTCGAACCTGTGATAGATTATATAACTTGTGATTGACTCCTCAATCACCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.50%	8.10%	1.12%	54.27%	NA
All Indica	2759	7.80%	11.90%	1.34%	78.91%	NA
All Japonica	1512	93.70%	2.70%	0.07%	3.51%	NA
Aus	269	7.10%	1.90%	3.35%	87.73%	NA
Indica I	595	6.60%	19.30%	0.84%	73.28%	NA
Indica II	465	4.50%	4.10%	0.65%	90.75%	NA
Indica III	913	2.80%	12.00%	1.31%	83.79%	NA
Indica Intermediate	786	16.50%	10.80%	2.16%	70.48%	NA
Temperate Japonica	767	96.20%	3.40%	0.00%	0.39%	NA
Tropical Japonica	504	88.90%	2.80%	0.20%	8.13%	NA
Japonica Intermediate	241	95.90%	0.40%	0.00%	3.73%	NA
VI/Aromatic	96	43.80%	2.10%	3.12%	51.04%	NA
Intermediate	90	35.60%	5.60%	3.33%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110517362	T -> DEL	N	N	silent_mutation	Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1110517362	T -> C	LOC_Os11g18640.1	upstream_gene_variant ; 1378.0bp to feature; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1110517362	T -> C	LOC_Os11g18630.1	downstream_gene_variant ; 1025.0bp to feature; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1110517362	T -> C	LOC_Os11g18630-LOC_Os11g18640	intergenic_region ; MODIFIER	silent_mutation	Average:11.467; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110517362	7.22E-06	NA	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	1.06E-07	NA	mr1210	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	4.94E-08	NA	mr1305	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	6.51E-06	NA	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	2.57E-06	NA	mr1409	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	7.55E-06	NA	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	2.14E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	NA	6.98E-06	mr1809	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	5.62E-06	NA	mr1820	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	2.70E-06	NA	mr1820	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110517362	3.11E-06	NA	mr1876	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251