\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110480312:

Variant ID: vg1110480312 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10480312
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGATCACAGTATCTAGAATTTCTACCATCATATGTAACAAGATAATAGTACAATAGTTATAATTCTTTTTTTTACAAAATCAAAACATAAAATCATTA[T/C,A]
AGTAAAGACTTATTAGCCATCAAGCTCATGCCGTTCGTCACTGTACATCTACAATACTCAACAAGTCTAAAATTATAAGGAACTTCTTTTAGCCTTGAAT

Reverse complement sequence

ATTCAAGGCTAAAAGAAGTTCCTTATAATTTTAGACTTGTTGAGTATTGTAGATGTACAGTGACGAACGGCATGAGCTTGATGGCTAATAAGTCTTTACT[A/G,T]
TAATGATTTTATGTTTTGATTTTGTAAAAAAAAGAATTATAACTATTGTACTATTATCTTGTTACATATGATGGTAGAAATTCTAGATACTGTGATCCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 3.60% 7.77% 44.10% A: 0.97%
All Indica  2759 18.70% 5.50% 8.45% 65.93% A: 1.38%
All Japonica  1512 96.10% 0.10% 1.79% 1.98% A: 0.07%
Aus  269 9.70% 4.50% 30.48% 53.16% A: 2.23%
Indica I  595 23.70% 6.40% 9.24% 60.00% A: 0.67%
Indica II  465 6.90% 12.30% 13.76% 66.24% A: 0.86%
Indica III  913 15.00% 1.20% 5.37% 76.45% A: 1.97%
Indica Intermediate  786 26.30% 5.90% 8.27% 58.02% A: 1.53%
Temperate Japonica  767 98.60% 0.00% 1.17% 0.26% NA
Tropical Japonica  504 92.30% 0.00% 3.37% 4.17% A: 0.20%
Japonica Intermediate  241 96.30% 0.40% 0.41% 2.90% NA
VI/Aromatic  96 30.20% 0.00% 6.25% 62.50% A: 1.04%
Intermediate  90 40.00% 3.30% 21.11% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110480312 T -> A LOC_Os11g18570.1 downstream_gene_variant ; 2563.0bp to feature; MODIFIER silent_mutation Average:28.498; most accessible tissue: Callus, score: 50.695 N N N N
vg1110480312 T -> A LOC_Os11g18570-LOC_Os11g18580 intergenic_region ; MODIFIER silent_mutation Average:28.498; most accessible tissue: Callus, score: 50.695 N N N N
vg1110480312 T -> DEL N N silent_mutation Average:28.498; most accessible tissue: Callus, score: 50.695 N N N N
vg1110480312 T -> C LOC_Os11g18570.1 downstream_gene_variant ; 2563.0bp to feature; MODIFIER silent_mutation Average:28.498; most accessible tissue: Callus, score: 50.695 N N N N
vg1110480312 T -> C LOC_Os11g18570-LOC_Os11g18580 intergenic_region ; MODIFIER silent_mutation Average:28.498; most accessible tissue: Callus, score: 50.695 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110480312 NA 5.70E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110480312 8.19E-06 6.03E-15 mr1595 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110480312 NA 1.67E-07 mr1595 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110480312 NA 7.84E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251