\
| Variant ID: vg1110480312 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10480312 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGGATCACAGTATCTAGAATTTCTACCATCATATGTAACAAGATAATAGTACAATAGTTATAATTCTTTTTTTTACAAAATCAAAACATAAAATCATTA[T/C,A]
AGTAAAGACTTATTAGCCATCAAGCTCATGCCGTTCGTCACTGTACATCTACAATACTCAACAAGTCTAAAATTATAAGGAACTTCTTTTAGCCTTGAAT
ATTCAAGGCTAAAAGAAGTTCCTTATAATTTTAGACTTGTTGAGTATTGTAGATGTACAGTGACGAACGGCATGAGCTTGATGGCTAATAAGTCTTTACT[A/G,T]
TAATGATTTTATGTTTTGATTTTGTAAAAAAAAGAATTATAACTATTGTACTATTATCTTGTTACATATGATGGTAGAAATTCTAGATACTGTGATCCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.60% | 3.60% | 7.77% | 44.10% | A: 0.97% |
| All Indica | 2759 | 18.70% | 5.50% | 8.45% | 65.93% | A: 1.38% |
| All Japonica | 1512 | 96.10% | 0.10% | 1.79% | 1.98% | A: 0.07% |
| Aus | 269 | 9.70% | 4.50% | 30.48% | 53.16% | A: 2.23% |
| Indica I | 595 | 23.70% | 6.40% | 9.24% | 60.00% | A: 0.67% |
| Indica II | 465 | 6.90% | 12.30% | 13.76% | 66.24% | A: 0.86% |
| Indica III | 913 | 15.00% | 1.20% | 5.37% | 76.45% | A: 1.97% |
| Indica Intermediate | 786 | 26.30% | 5.90% | 8.27% | 58.02% | A: 1.53% |
| Temperate Japonica | 767 | 98.60% | 0.00% | 1.17% | 0.26% | NA |
| Tropical Japonica | 504 | 92.30% | 0.00% | 3.37% | 4.17% | A: 0.20% |
| Japonica Intermediate | 241 | 96.30% | 0.40% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 30.20% | 0.00% | 6.25% | 62.50% | A: 1.04% |
| Intermediate | 90 | 40.00% | 3.30% | 21.11% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110480312 | T -> A | LOC_Os11g18570.1 | downstream_gene_variant ; 2563.0bp to feature; MODIFIER | silent_mutation | Average:28.498; most accessible tissue: Callus, score: 50.695 | N | N | N | N |
| vg1110480312 | T -> A | LOC_Os11g18570-LOC_Os11g18580 | intergenic_region ; MODIFIER | silent_mutation | Average:28.498; most accessible tissue: Callus, score: 50.695 | N | N | N | N |
| vg1110480312 | T -> DEL | N | N | silent_mutation | Average:28.498; most accessible tissue: Callus, score: 50.695 | N | N | N | N |
| vg1110480312 | T -> C | LOC_Os11g18570.1 | downstream_gene_variant ; 2563.0bp to feature; MODIFIER | silent_mutation | Average:28.498; most accessible tissue: Callus, score: 50.695 | N | N | N | N |
| vg1110480312 | T -> C | LOC_Os11g18570-LOC_Os11g18580 | intergenic_region ; MODIFIER | silent_mutation | Average:28.498; most accessible tissue: Callus, score: 50.695 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110480312 | NA | 5.70E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110480312 | 8.19E-06 | 6.03E-15 | mr1595 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110480312 | NA | 1.67E-07 | mr1595 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110480312 | NA | 7.84E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |