Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110425815:

Variant ID: vg1110425815 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10425815
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCCCTCCTTAGACTATGATTATTACAAGTAACATATAAATTATTAGTACATTTCTCTCTACTATCATCTTCCCACGGGATTAAATAAATACGATACCC[T/A]
TGGAATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAACTCTGTAACCATAATATACCAAGAGTATTTCTGCGCCATTGCTGG

Reverse complement sequence

CCAGCAATGGCGCAGAAATACTCTTGGTATATTATGGTTACAGAGTTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATTCCA[A/T]
GGGTATCGTATTTATTTAATCCCGTGGGAAGATGATAGTAGAGAGAAATGTACTAATAATTTATATGTTACTTGTAATAATCATAGTCTAAGGAGGGATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	5.40%	0.47%	1.46%	NA
All Indica	2759	97.10%	1.90%	0.54%	0.47%	NA
All Japonica	1512	99.30%	0.10%	0.00%	0.53%	NA
Aus	269	30.50%	67.30%	2.23%	0.00%	NA
Indica I	595	97.60%	0.20%	2.02%	0.17%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	97.70%	1.80%	0.00%	0.55%	NA
Indica Intermediate	786	94.50%	4.20%	0.38%	0.89%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	97.50%	0.40%	0.00%	2.07%	NA
VI/Aromatic	96	39.60%	11.50%	1.04%	47.92%	NA
Intermediate	90	91.10%	6.70%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110425815	T -> A	LOC_Os11g18490.1	missense_variant ; p.Gln169His; MODERATE	nonsynonymous_codon ; Q169H	Average:39.214; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	unknown	unknown	DELETERIOUS	0.01
vg1110425815	T -> DEL	LOC_Os11g18490.1	N	frameshift_variant	Average:39.214; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110425815	NA	8.34E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	2.89E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	5.97E-27	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	1.72E-29	mr1101	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.41E-08	1.18E-24	mr1113	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	7.87E-11	2.31E-30	mr1114	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.67E-11	4.00E-25	mr1116	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	4.85E-08	3.25E-28	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	7.27E-08	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.36E-06	8.22E-24	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.67E-06	1.12E-26	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	2.24E-08	8.19E-33	mr1123	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	1.32E-20	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.37E-10	2.23E-27	mr1242	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	2.82E-07	5.97E-29	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	5.33E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	9.64E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	5.23E-07	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	6.01E-06	NA	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	7.53E-12	9.07E-25	mr1496	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	2.40E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	5.56E-22	mr1589	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	7.59E-28	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	6.99E-28	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.69E-07	1.59E-25	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	1.93E-21	mr1936	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	6.52E-07	3.76E-26	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	1.13E-29	mr1098_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	2.09E-23	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.98E-09	9.07E-27	mr1113_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	5.10E-09	2.98E-26	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.88E-07	3.12E-26	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.83E-08	NA	mr1118_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	5.60E-09	4.25E-26	mr1119_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	3.63E-07	1.02E-28	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	3.81E-08	7.06E-30	mr1123_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.10E-08	2.75E-26	mr1240_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.21E-09	8.63E-25	mr1242_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	2.62E-28	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.29E-06	NA	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	1.22E-08	2.60E-18	mr1496_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	NA	1.00E-14	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	6.49E-07	1.10E-18	mr1936_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110425815	3.19E-06	5.33E-19	mr1961_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251