\
| Variant ID: vg1110399053 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10399053 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGGGAGAGAGAGGAGTGGCGCCGACATGCTGGCCCCACATGGTAGTGACTTGGGTGGCGGTCCGCGGTGGACCGGGTCCACGGACCGGAAGAGGGGCGG[C/T]
GCACCACGTGGCACTGACGTGGCGCCGACGCGGCGGCCACGCGGCAGCCACGCGGGCGAAAGAACATGGGTAGATCGGACGGCGGCAGAAACGCGTGGCT
AGCCACGCGTTTCTGCCGCCGTCCGATCTACCCATGTTCTTTCGCCCGCGTGGCTGCCGCGTGGCCGCCGCGTCGGCGCCACGTCAGTGCCACGTGGTGC[G/A]
CCGCCCCTCTTCCGGTCCGTGGACCCGGTCCACCGCGGACCGCCACCCAAGTCACTACCATGTGGGGCCAGCATGTCGGCGCCACTCCTCTCTCTCCCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 3.60% | 1.18% | 3.68% | NA |
| All Indica | 2759 | 94.40% | 1.20% | 0.69% | 3.70% | NA |
| All Japonica | 1512 | 98.80% | 0.10% | 0.07% | 1.06% | NA |
| Aus | 269 | 40.90% | 46.50% | 11.52% | 1.12% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.00% | 0.50% | NA |
| Indica II | 465 | 99.40% | 0.20% | 0.00% | 0.43% | NA |
| Indica III | 913 | 88.80% | 1.40% | 1.53% | 8.21% | NA |
| Indica Intermediate | 786 | 94.00% | 2.50% | 0.64% | 2.80% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 0.00% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 38.50% | 7.30% | 3.12% | 51.04% | NA |
| Intermediate | 90 | 90.00% | 3.30% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110399053 | C -> T | LOC_Os11g18420.1 | upstream_gene_variant ; 863.0bp to feature; MODIFIER | silent_mutation | Average:58.18; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1110399053 | C -> T | LOC_Os11g18430.1 | upstream_gene_variant ; 446.0bp to feature; MODIFIER | silent_mutation | Average:58.18; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1110399053 | C -> T | LOC_Os11g18440.1 | upstream_gene_variant ; 3054.0bp to feature; MODIFIER | silent_mutation | Average:58.18; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1110399053 | C -> T | LOC_Os11g18450.1 | downstream_gene_variant ; 3949.0bp to feature; MODIFIER | silent_mutation | Average:58.18; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1110399053 | C -> T | LOC_Os11g18420-LOC_Os11g18430 | intergenic_region ; MODIFIER | silent_mutation | Average:58.18; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| vg1110399053 | C -> DEL | N | N | silent_mutation | Average:58.18; most accessible tissue: Minghui63 flag leaf, score: 81.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110399053 | NA | 2.81E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 5.38E-24 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.53E-31 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.10E-29 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.19E-30 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 2.63E-06 | 4.21E-22 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 1.55E-08 | 2.04E-27 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 2.07E-08 | 2.30E-21 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 1.26E-07 | 3.10E-27 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 5.93E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 5.19E-06 | 4.25E-23 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 6.47E-08 | 2.93E-29 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 1.10E-06 | 1.69E-31 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 2.11E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 3.70E-20 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 7.49E-07 | 1.28E-22 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 2.89E-07 | 1.45E-29 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.10E-08 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 6.08E-07 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 2.60E-08 | 2.28E-21 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 6.72E-07 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 4.29E-41 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.58E-25 | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 2.12E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.47E-25 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.37E-25 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.65E-17 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 5.53E-06 | 3.53E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 4.24E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 4.14E-06 | 1.15E-22 | mr1936 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.22E-07 | mr1942 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 6.06E-25 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.58E-31 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 2.91E-24 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 5.15E-06 | 6.90E-23 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 5.78E-22 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 3.99E-24 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | 4.17E-06 | 7.58E-23 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.27E-27 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 5.19E-27 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.45E-22 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 5.79E-27 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 6.20E-15 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 6.95E-46 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 7.97E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 8.98E-16 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110399053 | NA | 1.29E-17 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |