Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1110343275:

Variant ID: vg1110343275 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10343275
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTTCTATTTTTTCTCTAATCAAGTCATATCATCTTAATTGTTTTTAGCCTTTAGATGATTAATCTACGGTCCAAACTATCTCCCTATATCTCTTATTCC[G/C]
TAAAGTCATACCACCTAACTTTTTACGTTTGAATCACCATTCTACATACTATTTGAATTTAAATTATCATAAACCACATTAATTTTCTTAATATGATGTT

Reverse complement sequence

AACATCATATTAAGAAAATTAATGTGGTTTATGATAATTTAAATTCAAATAGTATGTAGAATGGTGATTCAAACGTAAAAAGTTAGGTGGTATGACTTTA[C/G]
GGAATAAGAGATATAGGGAGATAGTTTGGACCGTAGATTAATCATCTAAAGGCTAAAAACAATTAAGATGATATGACTTGATTAGAGAAAAAATAGAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	7.10%	0.68%	1.67%	NA
All Indica	2759	99.30%	0.30%	0.14%	0.33%	NA
All Japonica	1512	76.10%	21.40%	1.85%	0.66%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.00%	0.20%	0.00%	0.77%	NA
Indica Intermediate	786	98.70%	0.60%	0.38%	0.25%	NA
Temperate Japonica	767	94.30%	3.50%	2.09%	0.13%	NA
Tropical Japonica	504	42.30%	56.00%	1.59%	0.20%	NA
Japonica Intermediate	241	89.20%	5.80%	1.66%	3.32%	NA
VI/Aromatic	96	39.60%	0.00%	0.00%	60.42%	NA
Intermediate	90	90.00%	7.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110343275	G -> DEL	N	N	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1110343275	G -> C	LOC_Os11g18340.1	upstream_gene_variant ; 787.0bp to feature; MODIFIER	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1110343275	G -> C	LOC_Os11g18320.2	downstream_gene_variant ; 3941.0bp to feature; MODIFIER	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg1110343275	G -> C	LOC_Os11g18340-LOC_Os11g18366	intergenic_region ; MODIFIER	silent_mutation	Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110343275	NA	4.02E-10	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275	NA	6.11E-12	mr1248	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275	NA	6.64E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275	NA	1.03E-10	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275	NA	1.53E-07	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251