\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110343275:

Variant ID: vg1110343275 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10343275
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCTATTTTTTCTCTAATCAAGTCATATCATCTTAATTGTTTTTAGCCTTTAGATGATTAATCTACGGTCCAAACTATCTCCCTATATCTCTTATTCC[G/C]
TAAAGTCATACCACCTAACTTTTTACGTTTGAATCACCATTCTACATACTATTTGAATTTAAATTATCATAAACCACATTAATTTTCTTAATATGATGTT

Reverse complement sequence

AACATCATATTAAGAAAATTAATGTGGTTTATGATAATTTAAATTCAAATAGTATGTAGAATGGTGATTCAAACGTAAAAAGTTAGGTGGTATGACTTTA[C/G]
GGAATAAGAGATATAGGGAGATAGTTTGGACCGTAGATTAATCATCTAAAGGCTAAAAACAATTAAGATGATATGACTTGATTAGAGAAAAAATAGAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 7.10% 0.68% 1.67% NA
All Indica  2759 99.30% 0.30% 0.14% 0.33% NA
All Japonica  1512 76.10% 21.40% 1.85% 0.66% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.00% 0.20% 0.00% 0.77% NA
Indica Intermediate  786 98.70% 0.60% 0.38% 0.25% NA
Temperate Japonica  767 94.30% 3.50% 2.09% 0.13% NA
Tropical Japonica  504 42.30% 56.00% 1.59% 0.20% NA
Japonica Intermediate  241 89.20% 5.80% 1.66% 3.32% NA
VI/Aromatic  96 39.60% 0.00% 0.00% 60.42% NA
Intermediate  90 90.00% 7.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110343275 G -> DEL N N silent_mutation Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1110343275 G -> C LOC_Os11g18340.1 upstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1110343275 G -> C LOC_Os11g18320.2 downstream_gene_variant ; 3941.0bp to feature; MODIFIER silent_mutation Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg1110343275 G -> C LOC_Os11g18340-LOC_Os11g18366 intergenic_region ; MODIFIER silent_mutation Average:26.786; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110343275 NA 4.02E-10 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275 NA 6.11E-12 mr1248 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275 NA 6.64E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275 NA 1.03E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110343275 NA 1.53E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251