\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110304932:

Variant ID: vg1110304932 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10304932
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACCTGGGTTCTGTGTCAACGCATGTAGGTCGTCTTCAATCGTGTGGCGCTTGTAAGTTCCTTGAAAGTTGGCTACAAACTACTGCCACAAGTCTGCCC[A/G]
CGAAGAGATCGAGTAGGGGGGAGGAGATGCATCAGCCATGAACGTGCAGAGCCTTTCAATGCGGTTGGCATGTAATTCGCCAACGCGTTGTCGTCCGCTC

Reverse complement sequence

GAGCGGACGACAACGCGTTGGCGAATTACATGCCAACCGCATTGAAAGGCTCTGCACGTTCATGGCTGATGCATCTCCTCCCCCCTACTCGATCTCTTCG[T/C]
GGGCAGACTTGTGGCAGTAGTTTGTAGCCAACTTTCAAGGAACTTACAAGCGCCACACGATTGAAGACGACCTACATGCGTTGACACAGAACCCAGGTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 44.50% 0.25% 7.17% NA
All Indica  2759 78.40% 19.00% 0.25% 2.32% NA
All Japonica  1512 3.80% 95.20% 0.13% 0.93% NA
Aus  269 1.90% 28.60% 0.37% 69.14% NA
Indica I  595 66.60% 32.90% 0.00% 0.50% NA
Indica II  465 97.80% 0.90% 0.22% 1.08% NA
Indica III  913 83.90% 13.60% 0.44% 2.08% NA
Indica Intermediate  786 69.50% 25.60% 0.25% 4.71% NA
Temperate Japonica  767 1.70% 97.90% 0.00% 0.39% NA
Tropical Japonica  504 8.10% 91.30% 0.40% 0.20% NA
Japonica Intermediate  241 1.20% 94.60% 0.00% 4.15% NA
VI/Aromatic  96 6.20% 22.90% 1.04% 69.79% NA
Intermediate  90 45.60% 44.40% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110304932 A -> DEL N N silent_mutation Average:42.826; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1110304932 A -> G LOC_Os11g18290.1 intron_variant ; MODIFIER silent_mutation Average:42.826; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110304932 NA 1.01E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1110304932 NA 4.82E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.21E-07 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.94E-06 mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 4.89E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.67E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.61E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.16E-24 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.01E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 5.70E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 9.57E-23 mr1260_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 4.84E-07 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.57E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 5.90E-23 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.51E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 8.94E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 4.55E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.47E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.65E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.70E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.13E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.83E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 8.25E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 4.03E-10 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.44E-23 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.14E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 4.28E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 6.82E-10 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 1.62E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 6.59E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 3.55E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110304932 NA 2.49E-07 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251