| Variant ID: vg1110300227 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10300227 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTTACACGACCAGATCTTACATTGTCTTTCGTCTCTACAGGATCCGACAAGGCCTTATCGGCTCTGGGCGTCCCCAGCCGAAGTTCCCTTAGTTTCCTC[A/G]
GAGGCCTTGTCAAGACGGCGTAAAGGGACATGAGGATAGGTGTCATCTGGGTAAGGGATCATCGGGAAGGAACACTTTGATTGTGGTCTTGACCTGAAAA
TTTTCAGGTCAAGACCACAATCAAAGTGTTCCTTCCCGATGATCCCTTACCCAGATGACACCTATCCTCATGTCCCTTTACGCCGTCTTGACAAGGCCTC[T/C]
GAGGAAACTAAGGGAACTTCGGCTGGGGACGCCCAGAGCCGATAAGGCCTTGTCGGATCCTGTAGAGACGAAAGACAATGTAAGATCTGGTCGTGTAAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 32.80% | 1.38% | 8.06% | NA |
| All Indica | 2759 | 88.00% | 7.10% | 0.91% | 4.02% | NA |
| All Japonica | 1512 | 13.00% | 84.50% | 1.65% | 0.93% | NA |
| Aus | 269 | 17.10% | 10.40% | 2.97% | 69.52% | NA |
| Indica I | 595 | 93.40% | 4.50% | 0.67% | 1.34% | NA |
| Indica II | 465 | 94.60% | 1.30% | 0.65% | 3.44% | NA |
| Indica III | 913 | 93.10% | 2.00% | 0.66% | 4.27% | NA |
| Indica Intermediate | 786 | 74.00% | 18.30% | 1.53% | 6.11% | NA |
| Temperate Japonica | 767 | 2.70% | 95.20% | 1.83% | 0.26% | NA |
| Tropical Japonica | 504 | 33.10% | 64.30% | 1.98% | 0.60% | NA |
| Japonica Intermediate | 241 | 3.30% | 92.50% | 0.41% | 3.73% | NA |
| VI/Aromatic | 96 | 8.30% | 22.90% | 4.17% | 64.58% | NA |
| Intermediate | 90 | 60.00% | 28.90% | 3.33% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110300227 | A -> DEL | LOC_Os11g18290.1 | N | frameshift_variant | Average:42.769; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg1110300227 | A -> G | LOC_Os11g18290.1 | synonymous_variant ; p.Ser1387Ser; LOW | synonymous_codon | Average:42.769; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110300227 | NA | 4.88E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | NA | 1.64E-10 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | NA | 1.65E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | NA | 1.27E-12 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | NA | 2.65E-19 | mr1218_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | 4.27E-06 | 4.27E-06 | mr1448_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | NA | 3.29E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110300227 | NA | 9.77E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |