\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110282765:

Variant ID: vg1110282765 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10282765
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGAATCGGCATCTTAAACCATTGTATATAAACGGCTACGTTAATGGGAAGCCGATGTCTAAAATGATGGTTTACAGTGGGGCCGTGGTGAATTTGATGC[C/T]
TTTTGCTACGTTCAGGAAGTTGGGTAGATGTGCCGAGGATCTCATCAAGACAAATATGGTGCTCAAATTCTTTGGTGGTAATCCATCGGAAACCAAAGGT

Reverse complement sequence

ACCTTTGGTTTCCGATGGATTACCACCAAAGAATTTGAGCACCATATTTGTCTTGATGAGATCCTCGGCACATCTACCCAACTTCCTGAACGTAGCAAAA[G/A]
GCATCAAATTCACCACGGCCCCACTGTAAACCATCATTTTAGACATCGGCTTCCCATTAACGTAGCCGTTTATATACAATGGTTTAAGATGCCGATTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 3.80% 0.85% 6.69% NA
All Indica  2759 97.60% 0.00% 0.25% 2.10% NA
All Japonica  1512 86.20% 11.70% 1.39% 0.73% NA
Aus  269 30.10% 0.00% 2.60% 67.29% NA
Indica I  595 99.70% 0.00% 0.17% 0.17% NA
Indica II  465 99.40% 0.00% 0.00% 0.65% NA
Indica III  913 97.60% 0.10% 0.22% 2.08% NA
Indica Intermediate  786 95.00% 0.00% 0.51% 4.45% NA
Temperate Japonica  767 95.80% 2.00% 1.96% 0.26% NA
Tropical Japonica  504 68.70% 30.20% 0.99% 0.20% NA
Japonica Intermediate  241 92.10% 4.10% 0.41% 3.32% NA
VI/Aromatic  96 36.50% 0.00% 2.08% 61.46% NA
Intermediate  90 85.60% 3.30% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110282765 C -> T LOC_Os11g18240.1 missense_variant ; p.Pro296Leu; MODERATE nonsynonymous_codon ; P296L Average:36.98; most accessible tissue: Zhenshan97 young leaf, score: 53.969 benign 0.909 DELETERIOUS 0.01
vg1110282765 C -> DEL LOC_Os11g18240.1 N frameshift_variant Average:36.98; most accessible tissue: Zhenshan97 young leaf, score: 53.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110282765 4.81E-06 1.19E-14 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 1.09E-06 1.04E-16 mr1017 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 8.43E-14 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 1.59E-06 4.78E-13 mr1019 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 7.45E-07 2.17E-17 mr1055 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 5.89E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 1.50E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 9.33E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 2.86E-14 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 4.55E-14 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 1.27E-12 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 6.63E-08 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 7.62E-12 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 9.24E-06 NA mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 5.14E-06 2.06E-17 mr1055_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 1.45E-07 1.24E-19 mr1132_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 1.04E-14 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 5.98E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 5.46E-06 1.10E-17 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 1.59E-06 8.09E-19 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 1.81E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110282765 NA 8.82E-08 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251