| Variant ID: vg1110131424 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 10131424 |
| Reference Allele: TC | Alternative Allele: CC,T |
| Primary Allele: TC | Secondary Allele: CC |
Inferred Ancestral Allele: Not determined.
GAAGGGAGGAAGGGAATAGTGGCGGCGGTGACGACGACAACAACAGCAGTAGAAGAAGGCGGCAACAATGACCCTCCCCTCCTCTCCTTCACACCCCCCC[TC/CC,T]
AGATATAGACGGAGGGGAGGAGGGCAATGGTGGCAGCGGCGACGACGGCACCAATAGCAGCAGAAGAAGGTGGCGATGGCAACCCTCCGCTCCTCTCCTT
AAGGAGAGGAGCGGAGGGTTGCCATCGCCACCTTCTTCTGCTGCTATTGGTGCCGTCGTCGCCGCTGCCACCATTGCCCTCCTCCCCTCCGTCTATATCT[GA/GG,A]
GGGGGGGTGTGAAGGAGAGGAGGGGAGGGTCATTGTTGCCGCCTTCTTCTACTGCTGTTGTTGTCGTCGTCACCGCCGCCACTATTCCCTTCCTCCCTTC
| Populations | Population Size | Frequency of TC(primary allele) | Frequency of CC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.00% | 9.80% | 1.14% | 0.00% | T: 0.06% |
| All Indica | 2759 | 90.90% | 7.50% | 1.56% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 98.90% | 0.50% | 0.60% | 0.00% | NA |
| Aus | 269 | 13.40% | 85.50% | 0.37% | 0.00% | T: 0.74% |
| Indica I | 595 | 86.20% | 12.10% | 1.68% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.10% | 0.43% | 0.00% | NA |
| Indica III | 913 | 93.00% | 6.40% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 9.20% | 3.18% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 1.20% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110131424 | TC -> CC | LOC_Os11g18010.1 | upstream_gene_variant ; 2256.0bp to feature; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> CC | LOC_Os11g18044.1 | upstream_gene_variant ; 1921.0bp to feature; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> CC | LOC_Os11g18020.1 | downstream_gene_variant ; 30.0bp to feature; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> CC | LOC_Os11g18020-LOC_Os11g18044 | intergenic_region ; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> T | LOC_Os11g18010.1 | upstream_gene_variant ; 2257.0bp to feature; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> T | LOC_Os11g18044.1 | upstream_gene_variant ; 1920.0bp to feature; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> T | LOC_Os11g18020.1 | downstream_gene_variant ; 31.0bp to feature; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| vg1110131424 | TC -> T | LOC_Os11g18020-LOC_Os11g18044 | intergenic_region ; MODIFIER | silent_mutation | Average:72.16; most accessible tissue: Zhenshan97 young leaf, score: 92.818 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110131424 | NA | 3.22E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110131424 | NA | 4.69E-06 | mr1109_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110131424 | 6.44E-06 | NA | mr1200_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110131424 | 1.39E-06 | 6.25E-07 | mr1255_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110131424 | NA | 2.41E-07 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110131424 | NA | 2.32E-07 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110131424 | NA | 5.90E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |