Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110106704:

Variant ID: vg1110106704 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10106704
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAAGCTATCTCCAACTTGACTCATTAGTAGCAAACAACAGTATTACATACATATAGTATCCATCTAGAAGTAACAATCATGAAATAATCATGGATATCC[A/G]
AACAAACAACCCGAAACCGAAACCGACACAGCGTTGGCCGGTCAGACCGCGGGCTGCGCTGGTCTGACCGCGCGATACACGTCGGTCTGATCGGCACACA

Reverse complement sequence

TGTGTGCCGATCAGACCGACGTGTATCGCGCGGTCAGACCAGCGCAGCCCGCGGTCTGACCGGCCAACGCTGTGTCGGTTTCGGTTTCGGGTTGTTTGTT[T/C]
GGATATCCATGATTATTTCATGATTGTTACTTCTAGATGGATACTATATGTATGTAATACTGTTGTTTGCTACTAATGAGTCAAGTTGGAGATAGCTTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	6.50%	0.11%	1.38%	NA
All Indica	2759	97.70%	2.20%	0.00%	0.04%	NA
All Japonica	1512	98.90%	0.40%	0.20%	0.53%	NA
Aus	269	21.90%	77.70%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	97.70%	2.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.70%	0.00%	0.13%	NA
Temperate Japonica	767	99.00%	0.70%	0.26%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	97.10%	0.40%	0.00%	2.49%	NA
VI/Aromatic	96	18.80%	24.00%	1.04%	56.25%	NA
Intermediate	90	91.10%	6.70%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110106704	A -> DEL	N	N	silent_mutation	Average:35.093; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg1110106704	A -> G	LOC_Os11g17980.1	upstream_gene_variant ; 2697.0bp to feature; MODIFIER	silent_mutation	Average:35.093; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg1110106704	A -> G	LOC_Os11g17970.1	downstream_gene_variant ; 3903.0bp to feature; MODIFIER	silent_mutation	Average:35.093; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg1110106704	A -> G	LOC_Os11g17990.1	downstream_gene_variant ; 1370.0bp to feature; MODIFIER	silent_mutation	Average:35.093; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg1110106704	A -> G	LOC_Os11g17980-LOC_Os11g17990	intergenic_region ; MODIFIER	silent_mutation	Average:35.093; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110106704	NA	3.59E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	3.15E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	3.54E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	9.39E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	4.56E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.63E-28	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.87E-26	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	4.11E-17	mr1113	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	3.54E-20	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.94E-21	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.87E-18	mr1119	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	3.98E-25	mr1120	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.78E-24	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	4.14E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.62E-06	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	1.76E-06	NA	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.49E-16	mr1240	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	4.37E-23	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	6.55E-07	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.27E-08	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.00E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.74E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	5.48E-06	mr1417	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.20E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.09E-13	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	4.08E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	5.60E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	5.03E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.74E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.32E-14	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	8.66E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.13E-25	mr1858	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.05E-25	mr1859	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.04E-17	mr1911	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.19E-22	mr1961	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.66E-17	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	3.97E-19	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.24E-17	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	8.19E-23	mr1120_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.52E-22	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	1.54E-07	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110106704	NA	2.61E-15	mr1961_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251