\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110037503:

Variant ID: vg1110037503 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10037503
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTGTTTCCTTTAGTTTCTATCCCGAGTTGGACGTGGAGAAGGGCCTGTAGAGGGCAAGACCAACCCCTATTTAAGGGACAAGGCCGTTTCATTGTAA[T/A]
ACCCCCGAATACAATCTACTTGAATCGTTCTTTTACCATGTTTTTCTATTTTACCCTAGTTTAGTCCATCTTTGTCGGTTTGTGCCGTAAACCGTCTGCC

Reverse complement sequence

GGCAGACGGTTTACGGCACAAACCGACAAAGATGGACTAAACTAGGGTAAAATAGAAAAACATGGTAAAAGAACGATTCAAGTAGATTGTATTCGGGGGT[A/T]
TTACAATGAAACGGCCTTGTCCCTTAAATAGGGGTTGGTCTTGCCCTCTACAGGCCCTTCTCCACGTCCAACTCGGGATAGAAACTAAAGGAAACACGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 0.10% 1.27% 48.43% NA
All Indica  2759 24.90% 0.10% 2.03% 72.96% NA
All Japonica  1512 97.90% 0.10% 0.00% 1.98% NA
Aus  269 23.00% 0.00% 1.12% 75.84% NA
Indica I  595 49.20% 0.00% 0.50% 50.25% NA
Indica II  465 22.60% 0.00% 2.80% 74.62% NA
Indica III  913 3.90% 0.00% 3.18% 92.88% NA
Indica Intermediate  786 32.30% 0.30% 1.40% 66.03% NA
Temperate Japonica  767 97.90% 0.00% 0.00% 2.09% NA
Tropical Japonica  504 97.20% 0.40% 0.00% 2.38% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 91.70% 0.00% 0.00% 8.33% NA
Intermediate  90 58.90% 2.20% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110037503 T -> A LOC_Os11g17890.1 downstream_gene_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:8.369; most accessible tissue: Callus, score: 32.847 N N N N
vg1110037503 T -> A LOC_Os11g17900.1 downstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:8.369; most accessible tissue: Callus, score: 32.847 N N N N
vg1110037503 T -> A LOC_Os11g17890-LOC_Os11g17900 intergenic_region ; MODIFIER silent_mutation Average:8.369; most accessible tissue: Callus, score: 32.847 N N N N
vg1110037503 T -> DEL N N silent_mutation Average:8.369; most accessible tissue: Callus, score: 32.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110037503 NA 8.32E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 5.08E-07 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 8.12E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 3.63E-08 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 6.76E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 2.12E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 3.25E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 1.23E-07 mr1453 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 4.72E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 7.59E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 1.83E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 1.13E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 NA 1.18E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 2.25E-06 2.24E-06 mr1869 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110037503 7.27E-07 5.27E-10 mr1886 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251