| Variant ID: vg1110030699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10030699 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGAAGGCATGTTTCGTGTTTCCTTTAGTTTCTATCCCGAGTTGGACGTGGAGAAGGGCCTGTAGAGGGCAAGACCAACCCCTATTTAAGGGACAAGGCCG[G/T]
TTCATTGTAAAACCCCTGAATATAATCTACTTGAATCATTCTTTTACCATGTTTCTTTTACCCTAGTTTAGTCCATCTTTGTCGGTTTGCACCGTAAACC
GGTTTACGGTGCAAACCGACAAAGATGGACTAAACTAGGGTAAAAGAAACATGGTAAAAGAATGATTCAAGTAGATTATATTCAGGGGTTTTACAATGAA[C/A]
CGGCCTTGTCCCTTAAATAGGGGTTGGTCTTGCCCTCTACAGGCCCTTCTCCACGTCCAACTCGGGATAGAAACTAAAGGAAACACGAAACATGCCTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.50% | 3.80% | 19.40% | 26.28% | NA |
| All Indica | 2759 | 31.90% | 0.00% | 29.32% | 38.75% | NA |
| All Japonica | 1512 | 85.20% | 11.80% | 1.52% | 1.52% | NA |
| Aus | 269 | 28.60% | 0.00% | 26.02% | 45.35% | NA |
| Indica I | 595 | 50.10% | 0.20% | 17.82% | 31.93% | NA |
| Indica II | 465 | 28.40% | 0.00% | 27.10% | 44.52% | NA |
| Indica III | 913 | 16.40% | 0.00% | 45.45% | 38.12% | NA |
| Indica Intermediate | 786 | 38.20% | 0.00% | 20.61% | 41.22% | NA |
| Temperate Japonica | 767 | 77.70% | 18.90% | 2.09% | 1.30% | NA |
| Tropical Japonica | 504 | 97.00% | 0.20% | 0.79% | 1.98% | NA |
| Japonica Intermediate | 241 | 84.20% | 13.30% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 2.08% | 6.25% | NA |
| Intermediate | 90 | 61.10% | 0.00% | 14.44% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110030699 | G -> T | LOC_Os11g17890.1 | upstream_gene_variant ; 1387.0bp to feature; MODIFIER | silent_mutation | Average:8.598; most accessible tissue: Callus, score: 16.923 | N | N | N | N |
| vg1110030699 | G -> T | LOC_Os11g17880-LOC_Os11g17890 | intergenic_region ; MODIFIER | silent_mutation | Average:8.598; most accessible tissue: Callus, score: 16.923 | N | N | N | N |
| vg1110030699 | G -> DEL | N | N | silent_mutation | Average:8.598; most accessible tissue: Callus, score: 16.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110030699 | 3.34E-06 | 6.98E-07 | mr1201 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030699 | NA | 1.84E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030699 | NA | 3.28E-07 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030699 | NA | 7.52E-07 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030699 | NA | 5.65E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110030699 | NA | 1.37E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |