\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110012449:

Variant ID: vg1110012449 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10012449
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.37, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGGGGCCTGAACCTGTATAAAAATCCCTGTCTCCATCTCTTTTACCTCAATCTCGCGTATATCCTAGCACCAACGATCCCCATACTGTCCAAATACC[A/G]
TAGTCGCGACATCAAACGACGACAGTGGCGCGCCAGGTAGGGGGATTTTGGTGCTTCAGGATTTCGACGAGATGGTTTCAAAAGATGGATTCTCCAGCAA

Reverse complement sequence

TTGCTGGAGAATCCATCTTTTGAAACCATCTCGTCGAAATCCTGAAGCACCAAAATCCCCCTACCTGGCGCGCCACTGTCGTCGTTTGATGTCGCGACTA[T/C]
GGTATTTGGACAGTATGGGGATCGTTGGTGCTAGGATATACGCGAGATTGAGGTAAAAGAGATGGAGACAGGGATTTTTATACAGGTTCAGGCCCCTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.10% 7.30% 1.52% 47.08% NA
All Indica  2759 20.10% 3.00% 1.85% 75.06% NA
All Japonica  1512 94.00% 4.00% 0.00% 2.05% NA
Aus  269 17.80% 44.60% 7.06% 30.48% NA
Indica I  595 38.80% 5.90% 0.84% 54.45% NA
Indica II  465 19.60% 0.00% 2.37% 78.06% NA
Indica III  913 3.40% 2.10% 2.08% 92.44% NA
Indica Intermediate  786 25.70% 3.60% 2.04% 68.70% NA
Temperate Japonica  767 93.60% 4.40% 0.00% 1.96% NA
Tropical Japonica  504 94.00% 3.20% 0.00% 2.78% NA
Japonica Intermediate  241 95.00% 4.10% 0.00% 0.83% NA
VI/Aromatic  96 19.80% 71.90% 0.00% 8.33% NA
Intermediate  90 45.60% 15.60% 2.22% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110012449 A -> DEL N N silent_mutation Average:17.274; most accessible tissue: Callus, score: 33.825 N N N N
vg1110012449 A -> G LOC_Os11g17880.1 upstream_gene_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:17.274; most accessible tissue: Callus, score: 33.825 N N N N
vg1110012449 A -> G LOC_Os11g17870-LOC_Os11g17880 intergenic_region ; MODIFIER silent_mutation Average:17.274; most accessible tissue: Callus, score: 33.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110012449 NA 3.88E-06 mr1101 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 5.53E-06 NA mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 5.38E-06 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 NA 5.57E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 5.80E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 NA 6.86E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 1.76E-06 3.42E-06 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 9.05E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 1.97E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 3.04E-06 1.44E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 5.55E-06 3.19E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 NA 2.81E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 NA 6.29E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 4.76E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 NA 8.00E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 1.08E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 1.27E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 9.84E-07 4.82E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 9.73E-07 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012449 6.05E-07 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251