\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110012268:

Variant ID: vg1110012268 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 10012268
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GATCTCGCCGGGCACGGATTCGAGGAGTAAGACTACCCTGTTGTCGACTACGAGTCAGATCTTCAGACCACCATGTCAACAACAGTTAGATAGGCTACCC[T/C]
AAATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTCGGCCAACAGGGTGTAGGGTTATTACCTGACAATTCAGGGGCCTGAACCTGTA

Reverse complement sequence

TACAGGTTCAGGCCCCTGAATTGTCAGGTAATAACCCTACACCCTGTTGGCCGAAGCCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATTT[A/G]
GGGTAGCCTATCTAACTGTTGTTGACATGGTGGTCTGAAGATCTGACTCGTAGTCGACAACAGGGTAGTCTTACTCCTCGAATCCGTGCCCGGCGAGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 4.90% 3.62% 46.70% NA
All Indica  2759 21.20% 3.40% 5.44% 69.95% NA
All Japonica  1512 93.90% 3.70% 0.40% 1.98% NA
Aus  269 19.00% 1.50% 2.97% 76.58% NA
Indica I  595 37.80% 7.40% 3.19% 51.60% NA
Indica II  465 20.20% 0.40% 5.38% 73.98% NA
Indica III  913 5.40% 3.40% 7.67% 83.57% NA
Indica Intermediate  786 27.50% 2.30% 4.58% 65.65% NA
Temperate Japonica  767 93.60% 4.00% 0.26% 2.09% NA
Tropical Japonica  504 93.80% 3.00% 0.79% 2.38% NA
Japonica Intermediate  241 95.00% 4.10% 0.00% 0.83% NA
VI/Aromatic  96 19.80% 70.80% 0.00% 9.38% NA
Intermediate  90 46.70% 10.00% 7.78% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1110012268 T -> DEL N N silent_mutation Average:15.595; most accessible tissue: Callus, score: 36.457 N N N N
vg1110012268 T -> C LOC_Os11g17880.1 upstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:15.595; most accessible tissue: Callus, score: 36.457 N N N N
vg1110012268 T -> C LOC_Os11g17870-LOC_Os11g17880 intergenic_region ; MODIFIER silent_mutation Average:15.595; most accessible tissue: Callus, score: 36.457 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1110012268 6.36E-07 NA mr1120 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268 7.68E-06 NA mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268 2.99E-06 NA mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268 NA 7.98E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268 2.65E-06 4.32E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251