Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110012268:

Variant ID: vg1110012268 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10012268
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

GATCTCGCCGGGCACGGATTCGAGGAGTAAGACTACCCTGTTGTCGACTACGAGTCAGATCTTCAGACCACCATGTCAACAACAGTTAGATAGGCTACCC[T/C]
AAATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTCGGCCAACAGGGTGTAGGGTTATTACCTGACAATTCAGGGGCCTGAACCTGTA

Reverse complement sequence

TACAGGTTCAGGCCCCTGAATTGTCAGGTAATAACCCTACACCCTGTTGGCCGAAGCCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATTT[A/G]
GGGTAGCCTATCTAACTGTTGTTGACATGGTGGTCTGAAGATCTGACTCGTAGTCGACAACAGGGTAGTCTTACTCCTCGAATCCGTGCCCGGCGAGATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.80%	4.90%	3.62%	46.70%	NA
All Indica	2759	21.20%	3.40%	5.44%	69.95%	NA
All Japonica	1512	93.90%	3.70%	0.40%	1.98%	NA
Aus	269	19.00%	1.50%	2.97%	76.58%	NA
Indica I	595	37.80%	7.40%	3.19%	51.60%	NA
Indica II	465	20.20%	0.40%	5.38%	73.98%	NA
Indica III	913	5.40%	3.40%	7.67%	83.57%	NA
Indica Intermediate	786	27.50%	2.30%	4.58%	65.65%	NA
Temperate Japonica	767	93.60%	4.00%	0.26%	2.09%	NA
Tropical Japonica	504	93.80%	3.00%	0.79%	2.38%	NA
Japonica Intermediate	241	95.00%	4.10%	0.00%	0.83%	NA
VI/Aromatic	96	19.80%	70.80%	0.00%	9.38%	NA
Intermediate	90	46.70%	10.00%	7.78%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110012268	T -> DEL	N	N	silent_mutation	Average:15.595; most accessible tissue: Callus, score: 36.457	N	N	N	N
vg1110012268	T -> C	LOC_Os11g17880.1	upstream_gene_variant ; 266.0bp to feature; MODIFIER	silent_mutation	Average:15.595; most accessible tissue: Callus, score: 36.457	N	N	N	N
vg1110012268	T -> C	LOC_Os11g17870-LOC_Os11g17880	intergenic_region ; MODIFIER	silent_mutation	Average:15.595; most accessible tissue: Callus, score: 36.457	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110012268	6.36E-07	NA	mr1120	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268	7.68E-06	NA	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268	2.99E-06	NA	mr1247	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268	NA	7.98E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110012268	2.65E-06	4.32E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251