\
| Variant ID: vg1109959621 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9959621 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 50. )
TAGCAATAGTATATGTTCTGATATCTTCATGAAATTCATTATTAAACTGACAACAACCCTTCAAAGCTGAACACTATATCGCTCATCCATTAGACCAGCT[A/G]
ATGCTACTACTATTTTTTTTCTGAGGAGCCAAATTGCTGCATAGGTATGTTTGATGGCCCTACGATTTAATTTGATAGCTCTGCTACATGTATACTTGAT
ATCAAGTATACATGTAGCAGAGCTATCAAATTAAATCGTAGGGCCATCAAACATACCTATGCAGCAATTTGGCTCCTCAGAAAAAAAATAGTAGTAGCAT[T/C]
AGCTGGTCTAATGGATGAGCGATATAGTGTTCAGCTTTGAAGGGTTGTTGTCAGTTTAATAATGAATTTCATGAAGATATCAGAACATATACTATTGCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.80% | 6.00% | 0.57% | 54.63% | NA |
| All Indica | 2759 | 11.80% | 7.70% | 0.80% | 79.70% | NA |
| All Japonica | 1512 | 93.50% | 3.00% | 0.07% | 3.44% | NA |
| Aus | 269 | 14.90% | 6.30% | 1.12% | 77.70% | NA |
| Indica I | 595 | 18.20% | 6.20% | 2.02% | 73.61% | NA |
| Indica II | 465 | 5.80% | 4.50% | 1.08% | 88.60% | NA |
| Indica III | 913 | 2.80% | 12.00% | 0.11% | 84.99% | NA |
| Indica Intermediate | 786 | 21.00% | 5.60% | 0.51% | 72.90% | NA |
| Temperate Japonica | 767 | 93.00% | 3.80% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 93.80% | 3.00% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.40% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 21.90% | 0.00% | 0.00% | 78.12% | NA |
| Intermediate | 90 | 37.80% | 8.90% | 1.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109959621 | A -> DEL | N | N | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| vg1109959621 | A -> G | LOC_Os11g17780.1 | upstream_gene_variant ; 4925.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| vg1109959621 | A -> G | LOC_Os11g17799.1 | upstream_gene_variant ; 1553.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| vg1109959621 | A -> G | LOC_Os11g17799.2 | upstream_gene_variant ; 1553.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| vg1109959621 | A -> G | LOC_Os11g17790.1 | downstream_gene_variant ; 2394.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| vg1109959621 | A -> G | LOC_Os11g17810.1 | downstream_gene_variant ; 3158.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| vg1109959621 | A -> G | LOC_Os11g17790-LOC_Os11g17799 | intergenic_region ; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 26.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109959621 | 5.60E-06 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | 4.78E-06 | 1.04E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | NA | 2.19E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | NA | 1.84E-09 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | 2.47E-06 | NA | mr1247 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | NA | 3.53E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | NA | 2.34E-22 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | NA | 6.30E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109959621 | NA | 2.51E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |