\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109955379:

Variant ID: vg1109955379 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 9955379
Reference Allele: TAlternative Allele: C,TATGTATACA,TA,TATG,TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAGCTAAGTAGAAAGAATAAAAAAAGGAAATCTATTCCTATACTTCTAGTATACATAATATACATACATTCTAGATATCTGATATACTAGCTAATACC[T/C,TATGTATACA,TA,TATG,TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC]
TCTATCCGATGCTCTCATGGTACTTCGAAAAGCCACTCCTGACTGCCGAGCTTCTTACGACAGCCCGTCATGACCATACAACCGGGGCTAAATACGGAGG

Reverse complement sequence

CCTCCGTATTTAGCCCCGGTTGTATGGTCATGACGGGCTGTCGTAAGAAGCTCGGCAGTCAGGAGTGGCTTTTCGAAGTACCATGAGAGCATCGGATAGA[A/G,TGTATACATA,TA,CATA,GGGTATTAGCTAGTATATCAGATAACTAGAATGTATGTATACATA]
GGTATTAGCTAGTATATCAGATATCTAGAATGTATGTATATTATGTATACTAGAAGTATAGGAATAGATTTCCTTTTTTTATTCTTTCTACTTAGCTTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 4.30% 2.03% 52.67% TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.11%; TA: 0.11%; TATGTATACA: 0.06%; TATG: 0.02%
All Indica  2759 13.40% 6.60% 2.39% 77.17% TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.18%; TA: 0.14%; TATGTATACA: 0.11%
All Japonica  1512 95.80% 0.70% 0.13% 3.24% TA: 0.07%
Aus  269 17.80% 1.90% 8.92% 71.38% NA
Indica I  595 20.80% 5.90% 1.85% 71.43% NA
Indica II  465 8.40% 1.50% 3.01% 86.24% TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.43%; TA: 0.43%
Indica III  913 2.80% 11.30% 2.30% 83.02% TATGTATACA: 0.33%; TA: 0.22%
Indica Intermediate  786 23.00% 4.70% 2.54% 69.34% TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.38%
Temperate Japonica  767 97.00% 0.00% 0.13% 2.87% NA
Tropical Japonica  504 94.40% 2.20% 0.00% 3.17% TA: 0.20%
Japonica Intermediate  241 95.00% 0.00% 0.41% 4.56% NA
VI/Aromatic  96 19.80% 0.00% 1.04% 78.12% TATG: 1.04%
Intermediate  90 42.20% 5.60% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109955379 T -> TA LOC_Os11g17770.1 upstream_gene_variant ; 4843.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TA LOC_Os11g17780.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TA LOC_Os11g17790.1 upstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TA LOC_Os11g17780-LOC_Os11g17790 intergenic_region ; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATG LOC_Os11g17770.1 upstream_gene_variant ; 4843.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATG LOC_Os11g17780.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATG LOC_Os11g17790.1 upstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATG LOC_Os11g17780-LOC_Os11g17790 intergenic_region ; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACA LOC_Os11g17770.1 upstream_gene_variant ; 4843.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACA LOC_Os11g17780.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACA LOC_Os11g17790.1 upstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACA LOC_Os11g17780-LOC_Os11g17790 intergenic_region ; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC LOC_Os11g17770.1 upstream_gene_variant ; 4843.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC LOC_Os11g17780.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC LOC_Os11g17790.1 upstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC LOC_Os11g17780-LOC_Os11g17790 intergenic_region ; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> DEL N N silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> C LOC_Os11g17770.1 upstream_gene_variant ; 4842.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> C LOC_Os11g17780.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> C LOC_Os11g17790.1 upstream_gene_variant ; 1645.0bp to feature; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N
vg1109955379 T -> C LOC_Os11g17780-LOC_Os11g17790 intergenic_region ; MODIFIER silent_mutation Average:17.789; most accessible tissue: Callus, score: 36.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109955379 2.68E-06 NA mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251