\
| Variant ID: vg1109949998 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9949998 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.27, others allele: 0.00, population size: 59. )
GGCTCCGGTAGGAATTTATATCAAATGAGGAACTTTCAAATTTAAGTCAAACTAGGATTAGGATCATAGTAACTCTTATTTACTATCTCGTATCTTGCAA[T/C]
AACTTAGACTCAGATTAGCAAGTGCAGCTCATTTACCTCAGGTTCCCAGATAATTGTTGGCTACTTATATTTAATCTTTGAGAGAGCACTTACCTATGAA
TTCATAGGTAAGTGCTCTCTCAAAGATTAAATATAAGTAGCCAACAATTATCTGGGAACCTGAGGTAAATGAGCTGCACTTGCTAATCTGAGTCTAAGTT[A/G]
TTGCAAGATACGAGATAGTAAATAAGAGTTACTATGATCCTAATCCTAGTTTGACTTAAATTTGAAAGTTCCTCATTTGATATAAATTCCTACCGGAGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.30% | 1.00% | 9.52% | 45.24% | NA |
| All Indica | 2759 | 18.80% | 1.60% | 11.85% | 67.78% | NA |
| All Japonica | 1512 | 96.20% | 0.00% | 0.40% | 3.44% | NA |
| Aus | 269 | 21.60% | 0.00% | 39.03% | 39.41% | NA |
| Indica I | 595 | 26.90% | 0.00% | 11.26% | 61.85% | NA |
| Indica II | 465 | 12.00% | 3.40% | 9.25% | 75.27% | NA |
| Indica III | 913 | 9.70% | 2.10% | 13.91% | 74.26% | NA |
| Indica Intermediate | 786 | 27.20% | 1.00% | 11.45% | 60.31% | NA |
| Temperate Japonica | 767 | 97.40% | 0.00% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 94.60% | 0.00% | 1.19% | 4.17% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 0.00% | 4.56% | NA |
| VI/Aromatic | 96 | 21.90% | 0.00% | 3.12% | 75.00% | NA |
| Intermediate | 90 | 44.40% | 3.30% | 10.00% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109949998 | T -> DEL | N | N | silent_mutation | Average:14.81; most accessible tissue: Callus, score: 31.754 | N | N | N | N |
| vg1109949998 | T -> C | LOC_Os11g17780.1 | downstream_gene_variant ; 2644.0bp to feature; MODIFIER | silent_mutation | Average:14.81; most accessible tissue: Callus, score: 31.754 | N | N | N | N |
| vg1109949998 | T -> C | LOC_Os11g17770.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.81; most accessible tissue: Callus, score: 31.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109949998 | NA | 8.93E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | 5.96E-06 | 5.70E-06 | mr1131_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | 1.59E-06 | 3.59E-07 | mr1147_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | NA | 9.41E-06 | mr1199_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | NA | 7.78E-06 | mr1264_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | NA | 7.98E-06 | mr1294_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | 3.06E-07 | 3.06E-07 | mr1356_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | 7.47E-06 | NA | mr1620_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109949998 | 3.30E-06 | 2.09E-06 | mr1831_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |