\
| Variant ID: vg1109870254 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9870254 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )
TAACCGAGGCGTCTGTCATAAACGCCGCTGCGGCCGGTTTACTCGAGGGCGAACTCACAAGGAAAATCGCCAACAATGAGCCACAGACGCTTGAGCACCT[A/G]
CTTCGCATCATTGATGGGTACGCAAGGGGCGAAGAGGATTCCAAGCGACGGCAAGCAATACAAGCTGAGTATGATAAGGCTTTCATCACTGCTGCCCAAG
CTTGGGCAGCAGTGATGAAAGCCTTATCATACTCAGCTTGTATTGCTTGCCGTCGCTTGGAATCCTCTTCGCCCCTTGCGTACCCATCAATGATGCGAAG[T/C]
AGGTGCTCAAGCGTCTGTGGCTCATTGTTGGCGATTTTCCTTGTGAGTTCGCCCTCGAGTAAACCGGCCGCAGCGGCGTTTATGACAGACGCCTCGGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 22.90% | 7.89% | 23.55% | NA |
| All Indica | 2759 | 19.60% | 37.10% | 11.45% | 31.86% | NA |
| All Japonica | 1512 | 96.70% | 0.10% | 0.93% | 2.25% | NA |
| Aus | 269 | 16.70% | 14.10% | 11.15% | 57.99% | NA |
| Indica I | 595 | 26.40% | 39.20% | 12.27% | 22.18% | NA |
| Indica II | 465 | 11.00% | 61.90% | 9.89% | 17.20% | NA |
| Indica III | 913 | 15.40% | 23.00% | 11.83% | 49.73% | NA |
| Indica Intermediate | 786 | 24.30% | 37.30% | 11.32% | 27.10% | NA |
| Temperate Japonica | 767 | 96.60% | 0.10% | 0.91% | 2.35% | NA |
| Tropical Japonica | 504 | 96.80% | 0.00% | 0.60% | 2.58% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.40% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 62.50% | 3.10% | 9.38% | 25.00% | NA |
| Intermediate | 90 | 56.70% | 16.70% | 4.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109870254 | A -> DEL | LOC_Os11g17690.1 | N | frameshift_variant | Average:12.679; most accessible tissue: Callus, score: 43.672 | N | N | N | N |
| vg1109870254 | A -> G | LOC_Os11g17690.1 | synonymous_variant ; p.Leu118Leu; LOW | synonymous_codon | Average:12.679; most accessible tissue: Callus, score: 43.672 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109870254 | NA | 1.11E-06 | mr1189 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 2.96E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | 2.08E-07 | 3.89E-14 | mr1457 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | 7.09E-07 | 2.30E-09 | mr1457 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 4.12E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 2.86E-06 | mr1625 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 9.51E-06 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 4.30E-06 | mr1725 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 8.89E-06 | mr1742 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 1.82E-07 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109870254 | NA | 2.04E-06 | mr1892 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |